ID: 921659424

View in Genome Browser
Species Human (GRCh38)
Location 1:217782196-217782218
Sequence AAGTATTAGAACAACGCTAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921659419_921659424 12 Left 921659419 1:217782161-217782183 CCTGTCTTGTCAGGGGCCCTTCC 0: 1
1: 0
2: 1
3: 5
4: 128
Right 921659424 1:217782196-217782218 AAGTATTAGAACAACGCTACAGG 0: 1
1: 0
2: 0
3: 2
4: 56
921659421_921659424 -5 Left 921659421 1:217782178-217782200 CCTTCCGAGATATCACCGAAGTA 0: 1
1: 0
2: 0
3: 1
4: 30
Right 921659424 1:217782196-217782218 AAGTATTAGAACAACGCTACAGG 0: 1
1: 0
2: 0
3: 2
4: 56
921659422_921659424 -9 Left 921659422 1:217782182-217782204 CCGAGATATCACCGAAGTATTAG 0: 1
1: 0
2: 1
3: 2
4: 45
Right 921659424 1:217782196-217782218 AAGTATTAGAACAACGCTACAGG 0: 1
1: 0
2: 0
3: 2
4: 56
921659418_921659424 18 Left 921659418 1:217782155-217782177 CCTCATCCTGTCTTGTCAGGGGC 0: 1
1: 0
2: 0
3: 23
4: 213
Right 921659424 1:217782196-217782218 AAGTATTAGAACAACGCTACAGG 0: 1
1: 0
2: 0
3: 2
4: 56
921659420_921659424 -4 Left 921659420 1:217782177-217782199 CCCTTCCGAGATATCACCGAAGT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 921659424 1:217782196-217782218 AAGTATTAGAACAACGCTACAGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921659424 Original CRISPR AAGTATTAGAACAACGCTAC AGG Exonic
906741137 1:48186679-48186701 AAATACTAGAAGAACGCTAGAGG - Intergenic
921659424 1:217782196-217782218 AAGTATTAGAACAACGCTACAGG + Exonic
1065566294 10:27013982-27014004 AAGTAGTAGAAAAACTATACAGG + Intronic
1067568763 10:47356710-47356732 ATGTATAAGAACAACTCTCCAGG - Intronic
1072823916 10:98586438-98586460 AAGTATTAGAAAAACACCAGTGG - Intronic
1072825756 10:98604633-98604655 AAGTACTATAACAGGGCTACAGG + Intronic
1087388139 11:97499588-97499610 AATTCTTACAACAACTCTACAGG - Intergenic
1087438818 11:98157460-98157482 AAGACTTTGAACCACGCTACTGG - Intergenic
1091371108 11:135058933-135058955 AAGTATTAAAACCAGGCTATTGG + Intergenic
1097605498 12:61748298-61748320 AATAATTAGAAAAACGCTAAAGG + Intronic
1099674369 12:85739052-85739074 AAGTAATAGAACAATGGTGCTGG - Intergenic
1101088512 12:101260447-101260469 AAGGTTTAGAACAACGCGAGAGG + Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1109152702 13:58863547-58863569 AAGGACTAGAAGAAAGCTACAGG + Intergenic
1109843318 13:67949676-67949698 AATTATTACAACAAAGCTCCTGG + Intergenic
1113655320 13:112064449-112064471 AAGTATTAAACCAAAGCTGCAGG - Intergenic
1114861512 14:26528800-26528822 AAGTATTAGAAGAAGACCACAGG - Intronic
1117012353 14:51483860-51483882 AACTCTTAGAACAACCCTAGAGG + Intergenic
1126837431 15:52680412-52680434 AAGTATTAGGACAAGTCTAAGGG + Intronic
1145054724 17:19693920-19693942 AACTATTAGAACAAGGTCACAGG + Intronic
1151382150 17:73733328-73733350 AACTATCAGCACAAGGCTACAGG - Intergenic
1159452029 18:68614487-68614509 AACTATTAGAATAACTCTACTGG - Intergenic
935441681 2:103105225-103105247 AAGTATTAGAAGAAACCCACAGG - Intergenic
936772806 2:115935458-115935480 AAATATTAGAAAGACCCTACCGG + Intergenic
943209528 2:184945401-184945423 AAGTAATTGCACAAAGCTACTGG - Intergenic
947944584 2:234090696-234090718 AATTCTTAAAACAACCCTACTGG + Intergenic
1178076432 21:29017263-29017285 AAGTAATAAAACAACTCTACTGG + Intronic
1178182515 21:30178648-30178670 AAATATTAGAAACACGCTAAGGG - Intergenic
949411654 3:3772170-3772192 AAATATGAGAACAAAGCTAATGG + Intronic
952514061 3:34085847-34085869 ATGTATTAAAACATCACTACGGG - Intergenic
953080405 3:39611385-39611407 ATGTATTAGAACAACACAAGGGG + Intergenic
956232231 3:67030056-67030078 AAGTTTTACAACAACCCTATGGG + Intergenic
957241871 3:77670390-77670412 AAGTATTAGAATGGCCCTACTGG + Intergenic
959183913 3:103019226-103019248 AAAAATTAGAAAAATGCTACTGG - Intergenic
959244136 3:103841842-103841864 AAGAATTAGAAAAACCTTACTGG + Intergenic
960410086 3:117312213-117312235 AAGCTTCAGAACAACACTACAGG + Intergenic
967898677 3:194424136-194424158 CTGTATTAGAACCATGCTACAGG - Intronic
968771354 4:2509516-2509538 CAGTATAAGAACAACACCACAGG - Intronic
983202414 4:164875078-164875100 AAGTGTCAGAACAATGCAACTGG - Intergenic
985883839 5:2660650-2660672 AAAAATTAGAAAAACTCTACTGG - Intergenic
992369809 5:76131214-76131236 GAGTATTAGAAGAATCCTACTGG - Intronic
1000044294 5:157508933-157508955 ATGTATTAGAACAAAGCGCCAGG + Intronic
1007273519 6:40656576-40656598 AAGTATTAGAACAATGGGAAAGG - Intergenic
1008639217 6:53444305-53444327 AAGTAATAGAACAAATCAACGGG + Intergenic
1012148382 6:95715346-95715368 AAGCATTAAAACAACTATACAGG + Intergenic
1018575259 6:165253107-165253129 AACTATTTGAACAACTCTATTGG + Intergenic
1020256708 7:6506473-6506495 AAGTCTTAGAACATGGCTGCAGG + Intronic
1038663092 8:29513949-29513971 AACTCTTAAAACAACGCTATTGG + Intergenic
1039035771 8:33357854-33357876 CAGTATTAGAACATCTCTAATGG - Intergenic
1050651614 9:7783007-7783029 AACTATTAAAACAAAGATACTGG + Intergenic
1051073644 9:13204285-13204307 ATGTATTAAAATAATGCTACTGG + Intronic
1055908121 9:81317049-81317071 AAGCATAAAAACAAAGCTACTGG - Intergenic
1058375909 9:104321187-104321209 TTGTACTAGAACAACTCTACTGG + Intergenic
1058641233 9:107087640-107087662 AAGTCTTCGAACAATTCTACAGG - Intergenic
1060693925 9:125689761-125689783 AAGAATGAGAGCAACGCTAGAGG + Intronic
1186400952 X:9259165-9259187 AAGTATGTGAACAAAGCTAATGG - Intergenic
1196188945 X:112774694-112774716 AAGTATTAAGACAACACCACAGG - Exonic
1196217043 X:113065433-113065455 AAGTATTGGAAAAACTCTCCAGG - Intergenic
1198187309 X:134266175-134266197 AAGCATTTGAACAACTCTAGCGG - Intergenic