ID: 921660120

View in Genome Browser
Species Human (GRCh38)
Location 1:217791300-217791322
Sequence AATTTCCACTGGAAATTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921660120_921660124 29 Left 921660120 1:217791300-217791322 CCAGCTAATTTCCAGTGGAAATT 0: 1
1: 0
2: 2
3: 16
4: 229
Right 921660124 1:217791352-217791374 TAATTTTTCTAATGAAGTTCTGG 0: 1
1: 0
2: 5
3: 43
4: 949

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921660120 Original CRISPR AATTTCCACTGGAAATTAGC TGG (reversed) Intronic
904510374 1:31000877-31000899 AATTTCAAATATAAATTAGCTGG + Intronic
905122847 1:35695165-35695187 CATTTCTACTAAAAATTAGCTGG - Intergenic
906986646 1:50690155-50690177 AGTTTCTACTTAAAATTAGCCGG - Intronic
907290018 1:53407594-53407616 AATTTCCACAGGAGATTTGGAGG - Intergenic
909520799 1:76565455-76565477 AAATTCCTCTGGAAAATAGCAGG + Intronic
909892415 1:81024129-81024151 TATTTGCACAGGAAAATAGCTGG + Intergenic
910703357 1:90100884-90100906 AAGTTCCAGTGGGAACTAGCTGG - Intergenic
911335978 1:96580911-96580933 AATTTCCAGTTGCAATTAGGAGG - Intergenic
911337079 1:96594199-96594221 AATCTCCACTTGAAATAAGGAGG + Intergenic
915794866 1:158719027-158719049 AGTTTCCATTAGTAATTAGCAGG - Intergenic
919295012 1:195686788-195686810 GAATTCAGCTGGAAATTAGCTGG + Intergenic
920701943 1:208224550-208224572 AATTTCCTATGGAAAATAGCGGG + Intronic
921443116 1:215212764-215212786 TTCTTCCAGTGGAAATTAGCAGG + Intronic
921660120 1:217791300-217791322 AATTTCCACTGGAAATTAGCTGG - Intronic
921745425 1:218735102-218735124 AATTTACACATTAAATTAGCTGG + Intergenic
923217103 1:231858405-231858427 AAGATCCACAGGAAATTAACTGG - Intronic
923988044 1:239403621-239403643 ACTGGCCACTAGAAATTAGCTGG - Intronic
1064232903 10:13545218-13545240 AATTTACACTCCAAATTAGTGGG + Intergenic
1064771948 10:18732418-18732440 AATATCCAGTGGAAATTATCTGG - Intergenic
1064785479 10:18889935-18889957 ATTTTTCAATGGAAATTATCTGG - Intergenic
1066616316 10:37298620-37298642 AATTGCAACTGAAATTTAGCAGG - Intronic
1066780924 10:38943569-38943591 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1066833954 10:39790082-39790104 AATTTCCAATGGAGATTTCCAGG + Intergenic
1066834645 10:39802312-39802334 AATTTCCAATGGAGATTTCCAGG + Intergenic
1066835149 10:39811481-39811503 AATTTCCAATGGAGATTTCCAGG + Intergenic
1066835790 10:39823030-39823052 AATTTCCACTGGAGATTTCTAGG + Intergenic
1066841683 10:39929033-39929055 AATTTCCAATGGAGATTTCCAGG + Intergenic
1068202602 10:53801778-53801800 AATTTACACTGGCATTTAGCCGG + Intergenic
1068636112 10:59350162-59350184 AATTCCCACTGGAATTTAAGTGG - Intronic
1069181484 10:65365493-65365515 AAGTTGCACTGTAAATTAGTAGG - Intergenic
1069238580 10:66109489-66109511 AATATCCCCTGGAAATTTGGAGG + Intronic
1071771517 10:88734135-88734157 AATTTCTACTAGGAATTAGTAGG - Intronic
1072268513 10:93753087-93753109 TAGTTCCACTGGAAATAAGTGGG - Intergenic
1074054984 10:109914983-109915005 AATTTTGTCTGGAAATTAGATGG - Intronic
1078151065 11:8760025-8760047 CTTTTCCACAGGAATTTAGCAGG - Intronic
1079400735 11:20104411-20104433 AATGGCCAGTGGAAATGAGCCGG - Intronic
1079566913 11:21893777-21893799 AATTACCACTGGAAATAAAAGGG - Intergenic
1080851728 11:36076316-36076338 AATTTCCAATGGAAATTTGAAGG - Intronic
1081061420 11:38482209-38482231 ATTTTCAACTGTAAATTACCTGG + Intergenic
1081116092 11:39203390-39203412 AGTCTCCACTAAAAATTAGCTGG + Intergenic
1082687018 11:56251983-56252005 AATTTCAACTGAAAATTAACTGG + Intergenic
1086391875 11:86373807-86373829 TATTGCCACTAAAAATTAGCTGG + Intergenic
1091610396 12:2002939-2002961 AAATTCCCCTGGAAACTAGGGGG + Intronic
1092337211 12:7643616-7643638 AATATCACCAGGAAATTAGCAGG + Intergenic
1093458509 12:19387310-19387332 AATACCCTCTGGAAAATAGCAGG + Intergenic
1094053522 12:26245746-26245768 AATTTCCAATGGCAATTAATTGG + Intronic
1094462639 12:30713841-30713863 AATTTCCATTGGAAATTGAAGGG + Exonic
1095420111 12:42016662-42016684 GAGTTCCATTGGAAATTAGTTGG + Intergenic
1098536447 12:71598703-71598725 AATCTCCACTGAAATTTGGCTGG - Intergenic
1098712086 12:73775516-73775538 AAATTCCACTGGGAAATAACAGG - Intergenic
1100165037 12:91907359-91907381 AATTTCCACAGGTCATTAGAGGG + Intergenic
1100332312 12:93595928-93595950 ATTTGCTACTGGAAAGTAGCTGG - Intergenic
1100672567 12:96832857-96832879 TATTTTCAGTGGAAGTTAGCTGG - Intronic
1100812536 12:98353599-98353621 TATTTCCCCTGGAAATACGCAGG + Intergenic
1101341716 12:103847922-103847944 ACATTCCACTGGAAATAAGATGG - Intergenic
1101426718 12:104594251-104594273 ATTTTCCTCTGCAAATGAGCAGG + Intronic
1102418008 12:112781226-112781248 AATATCCTCTGGAACTTACCTGG + Intronic
1104361301 12:128135658-128135680 AATTTCCACTTGCATTGAGCTGG - Intergenic
1110703656 13:78579415-78579437 AATTTTCACTATAAATTATCTGG - Intergenic
1110875133 13:80500336-80500358 AATTTCCACTGGATGCTATCTGG - Intergenic
1111019299 13:82425872-82425894 AATTTCCTTTGGAAATGAGTGGG + Intergenic
1111402000 13:87749934-87749956 TATTTCCACTGGAAATATACTGG + Intergenic
1111872631 13:93852475-93852497 GATTTCTACTGGAAATTTTCAGG + Intronic
1112314935 13:98352292-98352314 AATTGCCACTGGAAATCACAGGG + Intronic
1113969576 13:114178409-114178431 AATTTGCTCTGAATATTAGCAGG - Intergenic
1116737762 14:48715628-48715650 AATTTCCACTGGGAACTGGATGG + Intergenic
1202939661 14_KI270725v1_random:135585-135607 AAGATCCCCTGGAAATTAGGTGG - Intergenic
1127905200 15:63371278-63371300 AATTTCCTTTGGAAATCAGGGGG - Intronic
1128287381 15:66448549-66448571 AATTTTCCCTGGAAATGAGAGGG - Intronic
1129878448 15:78992228-78992250 AATTTCCTTTTGAAACTAGCAGG + Intronic
1130021868 15:80238644-80238666 CATTTCTACTAAAAATTAGCTGG - Intergenic
1130852686 15:87811945-87811967 ATTTTCCTCTGGAACTTATCTGG + Intergenic
1131582519 15:93658726-93658748 AATGTCCTTTGCAAATTAGCAGG - Intergenic
1132134309 15:99319695-99319717 AATTTCTACTGGGAATTAATTGG + Intronic
1136696086 16:32083516-32083538 AAGATCCCCTGGAAATTAGGTGG - Intergenic
1136715771 16:32279864-32279886 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1136752142 16:32649903-32649925 AAGATCCCCTGGAAATTAGGTGG - Intergenic
1136771430 16:32845193-32845215 AAGATCCCCTGGAAATTAGGTGG - Intergenic
1136796580 16:33026768-33026790 AAGATCCCCTGGAAATTAGGTGG - Intergenic
1136822453 16:33330559-33330581 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1136829016 16:33387098-33387120 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1136834082 16:33485880-33485902 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1136868127 16:33772002-33772024 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1136899150 16:34016232-34016254 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1137084034 16:36100394-36100416 AAGATCCCCTGGAAATTAGGTGG - Intergenic
1137496914 16:48977109-48977131 AAGATCCACTGGACATGAGCAGG - Intergenic
1137648597 16:50098103-50098125 TATTTAAACTGGAAATTATCAGG - Intronic
1203010834 16_KI270728v1_random:238640-238662 AAGATCCCCTGGAAATTAGGTGG - Intergenic
1203054283 16_KI270728v1_random:909887-909909 AAGATCCCCTGGAAATTAGGTGG - Intergenic
1203073855 16_KI270728v1_random:1107304-1107326 AAGATCCCCTGGAAATTAGGTGG - Intergenic
1203104048 16_KI270728v1_random:1344274-1344296 AAGATCCCCTGGAAATTAGGTGG - Intergenic
1203129466 16_KI270728v1_random:1618094-1618116 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1145690394 17:26732712-26732734 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1145710168 17:26963866-26963888 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1145766896 17:27464383-27464405 AAGATCCCCTGGAAATTAGGTGG + Intronic
1146421487 17:32690528-32690550 AATTTCAACTGGAGATTCGAAGG - Intronic
1148993763 17:51689630-51689652 AATTGTCACTGGCAATCAGCAGG - Intronic
1150240216 17:63625238-63625260 AATTTCCACTAGAAATTCATTGG - Intronic
1150690638 17:67364129-67364151 AGTTTCAACTGTAAATTAGATGG - Intronic
1151263565 17:72936440-72936462 AAATTCCCCTGGCAATTACCCGG + Intronic
1151449175 17:74187257-74187279 AATTTCCACTGGCATCTAGTGGG - Intergenic
1155724852 18:29068340-29068362 AATTTCCACTGGAATTAACTTGG + Intergenic
1155847115 18:30721820-30721842 AATTTGCACTGAAATTTATCTGG - Intergenic
1156259607 18:35432661-35432683 AATTGCCAGTGGAAATCTGCAGG - Intergenic
1158497181 18:57966997-57967019 AATTTCCACAGGATTTTTGCTGG + Intergenic
1159609656 18:70511441-70511463 CATTTCCACTGCAAACTAGAAGG + Intergenic
1161483444 19:4522314-4522336 CATTACCACTTAAAATTAGCCGG - Intergenic
1163057067 19:14728049-14728071 CATCTCTACTGAAAATTAGCCGG + Intronic
1164823922 19:31270332-31270354 AATGTCCAGTGGAAATTTGTTGG + Intergenic
1165752545 19:38269347-38269369 AATTTCCACTGGAGGCAAGCAGG + Intronic
1167763816 19:51466298-51466320 AATGTTCACTAGAAATCAGCAGG - Intergenic
1167947427 19:52999979-53000001 CGTTTCCACTAAAAATTAGCTGG + Intergenic
1168439175 19:56348710-56348732 AATATCACCAGGAAATTAGCAGG + Intronic
926802313 2:16669420-16669442 AATTTCTGCTGGAGATTAGTGGG - Intergenic
927775708 2:25901217-25901239 CATTTCTACTAAAAATTAGCCGG - Intergenic
928140705 2:28726580-28726602 AATTTCCACTGGGAATTAACAGG + Intergenic
928307078 2:30179062-30179084 GCTTTCCGCTGGAAATTAGAAGG + Intergenic
931882118 2:66578283-66578305 AGTTTCCACTGGACAAAAGCAGG + Intergenic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
935099052 2:99975027-99975049 ATTTTCCACTTGAAATAACCAGG + Intronic
935102794 2:100012575-100012597 AATTTTCACTTGTAATTAGTGGG - Intronic
938518005 2:132037017-132037039 AAGATCCCCTGGAAATTAGGTGG - Intergenic
938855744 2:135308478-135308500 TATTTCCACTGGCATCTAGCAGG - Intronic
939059913 2:137409262-137409284 AATTTCAGCTGGAGATTTGCAGG + Intronic
942555280 2:177166592-177166614 AATTTCCACTGGAAATAAAACGG - Intergenic
943022390 2:182590831-182590853 CATTTCCAGTGCAAATTAGTGGG - Intergenic
944468531 2:200028535-200028557 AATTCCCATTAGAAATTAGTTGG - Intergenic
945141756 2:206693947-206693969 AATGCCCACTGGAAATTATTTGG + Intronic
945770982 2:214042253-214042275 AACTTCCAGCTGAAATTAGCTGG - Intronic
947341541 2:229145305-229145327 AATTTCCACTGGAAACCATAAGG + Intronic
947775344 2:232704564-232704586 CATTTCTACTAAAAATTAGCTGG - Intronic
948096663 2:235340674-235340696 AACTTGCTCTGGAAAGTAGCAGG - Intergenic
1169133312 20:3179477-3179499 AATTTCTAATAAAAATTAGCTGG - Intergenic
1169625042 20:7556800-7556822 AATTTCCACTGGAGTGGAGCTGG + Intergenic
1171435652 20:25121155-25121177 AATTTCTACTGACAATTAGTAGG - Intergenic
1173526175 20:43734638-43734660 TAGTTCCACAGGAAACTAGCTGG - Intergenic
1175742361 20:61428865-61428887 AATTTTCCCTGGAACATAGCTGG - Intronic
1176583527 21:8551500-8551522 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1176905240 21:14492657-14492679 ACTTTTCACTGGAAATTTTCTGG + Intronic
1177903363 21:26945071-26945093 AACTTGCAAAGGAAATTAGCAGG + Intronic
1179841177 21:44074933-44074955 AATTTCTTCTAGAATTTAGCTGG + Intronic
1180266337 22:10528431-10528453 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1184887445 22:47355136-47355158 ACATTCCATTGGAAATAAGCAGG + Intergenic
1203289027 22_KI270735v1_random:16738-16760 AAGATCCCCTGGAAATTAGGTGG - Intergenic
1203324795 22_KI270738v1_random:3921-3943 AAGATCCCCTGGAAATTAGGTGG - Intergenic
951558116 3:23941698-23941720 ACTGGCCACTGGAAATTCGCTGG - Intronic
953296112 3:41718736-41718758 AATTTACAATGGAAATTGGTTGG - Intronic
953669748 3:44952439-44952461 AGTTTACTCTGGAAATTAGTTGG - Intronic
954914356 3:54136046-54136068 GATTTCCAGTGGAGATCAGCTGG - Intronic
955764318 3:62325366-62325388 AAATTCCTTTGGAAAGTAGCAGG + Intronic
956256329 3:67286846-67286868 CTTTTCCACTGCAAATTAGCAGG - Intergenic
956462845 3:69488729-69488751 CATCTCCACTAAAAATTAGCTGG + Intronic
956720722 3:72115188-72115210 AGTTTCCATTGGCATTTAGCGGG + Intergenic
958640881 3:96802912-96802934 AATTTCAACAGAAAATCAGCAGG + Intergenic
959136126 3:102423579-102423601 AATTTTTAATGGAAATTAGAAGG - Intronic
959567456 3:107847146-107847168 ACTTTCCAGTTGAAATTAGAAGG - Intergenic
960343938 3:116509283-116509305 AATTTCCACAGGACAATAGAGGG - Intronic
960361355 3:116715790-116715812 AATTTTCCCTGGAAAGTATCTGG - Intronic
960509829 3:118536075-118536097 AATCTCTACTCAAAATTAGCTGG + Intergenic
960660766 3:120055831-120055853 AATTTCCACTAGAATTTATTCGG + Intronic
960738240 3:120803988-120804010 ATTTTCCACTGGACATGGGCGGG + Intergenic
961122039 3:124381051-124381073 AATTTGCACTAGAAAGTAGCAGG + Intronic
962660107 3:137593476-137593498 AATTTCCACTGGAATAAAGCAGG + Intergenic
964344014 3:155738034-155738056 AATTGCCACTGGATGTCAGCGGG - Intronic
964531320 3:157671078-157671100 AATTTTCTTTGGAAATTAGATGG + Intronic
964556072 3:157940255-157940277 AATTTCCACTGGCAATGTGGGGG + Intergenic
964583559 3:158269147-158269169 AATTAAAACTGGAAATTAACTGG - Intronic
965339393 3:167468286-167468308 GATTTCTACTGGAAATAAGGAGG + Intronic
966892924 3:184420494-184420516 AATTTCCACTGTAAGTTAGCTGG - Intronic
968856045 4:3123328-3123350 AAGTTCTACTGGAACATAGCTGG - Intronic
969426164 4:7125395-7125417 AGTTTCCACGGCAAATAAGCCGG + Intergenic
971989838 4:33878255-33878277 AATTTCTTCTGGAAATTTTCAGG + Intergenic
975196056 4:71525037-71525059 TTTTTCCACTGTAAATTAACTGG + Intronic
975425498 4:74221987-74222009 AATTTTTACTGGCAAATAGCAGG - Intronic
975755656 4:77568932-77568954 AATTTGCAGGGGAAAATAGCTGG + Intronic
977265727 4:94851029-94851051 TATTTCCACTGGGAATTCTCAGG + Intronic
979030875 4:115644595-115644617 AATTTATTCTGGAAATTAGCTGG + Intergenic
981155366 4:141428644-141428666 AATTTCCACTGAAAAATTTCTGG + Intergenic
982266800 4:153545242-153545264 AAATTTCACTGGAAATGAGAAGG - Intronic
982376132 4:154692854-154692876 TTTGGCCACTGGAAATTAGCAGG - Intronic
983844861 4:172505597-172505619 ATTTTCCTCTGGTAATGAGCAGG + Intronic
986033233 5:3912843-3912865 AATTTCCAAGGGAAGTAAGCCGG - Intergenic
987227230 5:15855106-15855128 AATTTTCTATGAAAATTAGCAGG - Intronic
989073254 5:37534039-37534061 AATTTCCACAGGAACATACCAGG - Intronic
992698133 5:79311510-79311532 AATTTCCATTTGAAATTATCTGG + Intronic
993766337 5:91863350-91863372 AATTCCCACTGGAAATGGGAAGG + Intergenic
995973353 5:118000807-118000829 GATTCCAAATGGAAATTAGCAGG - Intergenic
1000934423 5:167291162-167291184 AATTTCCACTGAGAAAGAGCAGG - Intronic
1005586431 6:27280661-27280683 AATTACCACAAGAAAATAGCCGG + Intergenic
1007395000 6:41572615-41572637 AATTTTCACTGGGAACTGGCTGG - Intronic
1009944537 6:70327881-70327903 AATTTCCACTTAAAATTCACAGG - Intergenic
1009948757 6:70370118-70370140 AATTTCCAGTGGAAGTTTCCTGG - Intergenic
1013641849 6:112091367-112091389 AAGAACCACTGGAAATAAGCGGG + Intronic
1014048157 6:116918346-116918368 ATTTTTCAATGGAAACTAGCTGG + Intronic
1016135696 6:140539128-140539150 AAATTACACTAGAAATCAGCTGG - Intergenic
1017492205 6:154954698-154954720 ATTTTCCAGTGCAAATTAGGAGG - Intronic
1018494326 6:164333473-164333495 AATTTCTAATGTAAAGTAGCAGG - Intergenic
1021101692 7:16591719-16591741 AATCTCCTCTGGAAATTCCCAGG + Intergenic
1022220299 7:28307632-28307654 AAATGCCACTGGAAATTAGTTGG + Intronic
1022789234 7:33670354-33670376 ATTTTCCACTGTAAACAAGCTGG + Intergenic
1025320567 7:58089028-58089050 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1025553180 7:62274677-62274699 AAGATCCCCTGGAAATTAGGTGG - Intergenic
1025840598 7:65142167-65142189 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1025878117 7:65507997-65508019 AAGATCCCCTGGAAATTAGGTGG - Intergenic
1025882454 7:65553792-65553814 AAGATCCCCTGGAAATTAGGTGG - Intergenic
1025890989 7:65648811-65648833 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1026296105 7:69053594-69053616 AATTTTCTCTAAAAATTAGCTGG + Intergenic
1026572915 7:71547453-71547475 TATTTCTACTAAAAATTAGCTGG - Intronic
1027347846 7:77280069-77280091 AATGTCCACTGGACATAAGGTGG - Intronic
1027869091 7:83683600-83683622 AATTTCCATTTGAAATTATATGG + Intergenic
1028588182 7:92471446-92471468 AATTTCCATTGGATAGTTGCAGG + Intronic
1028809078 7:95062962-95062984 AACTTCCATTGGAAATTGACTGG + Intronic
1032522963 7:132560327-132560349 TTTTTCCACTGGAAAGTAGTGGG + Intronic
1033258976 7:139825906-139825928 GATTTCCAATGCATATTAGCAGG + Intronic
1034130183 7:148708726-148708748 AATTTTCACTTGAAAGTAGCTGG + Intronic
1039200197 8:35082764-35082786 CATTTCCACAGGACATTAGAGGG - Intergenic
1041236931 8:55812513-55812535 AAATTACAGTGTAAATTAGCTGG + Intronic
1041239912 8:55840538-55840560 AATGTACAGTGGAAACTAGCAGG - Intergenic
1042775252 8:72423461-72423483 AATGACCATTGGAAACTAGCAGG - Intergenic
1042880887 8:73487368-73487390 AATTTCCAATGGCTATTAGTGGG - Intronic
1044606426 8:94051977-94051999 AATTTCCAAAGGGAATTATCAGG - Intergenic
1046113608 8:109757605-109757627 AATTCTCAAAGGAAATTAGCTGG + Intergenic
1046505069 8:115126490-115126512 AATTGTCAGTGGAAAATAGCAGG - Intergenic
1051478172 9:17531516-17531538 AGTTTTCACTGGGAATTAGGGGG + Intergenic
1051569520 9:18540153-18540175 AATATCCACTGGGATTTACCAGG + Intronic
1051977190 9:22965279-22965301 AAATCCCACTGGAAAATAGCAGG + Intergenic
1057091979 9:92266543-92266565 AATTTCAACTTGAGATTTGCTGG - Intronic
1057892450 9:98879806-98879828 AATTTCCACAGGAAACTGGAAGG + Intergenic
1058036879 9:100262325-100262347 AATTTCCTCTTGAAGTTATCTGG + Intronic
1059577760 9:115509378-115509400 AATATCCAGTAGAAATCAGCGGG + Intergenic
1060160903 9:121362536-121362558 AACTTACACAGGAAATAAGCAGG - Intronic
1062078329 9:134604373-134604395 GATTCTCACTGGAAATTAGGAGG + Intergenic
1203613487 Un_KI270749v1:29271-29293 AAGATCCCCTGGAAATTAGGTGG + Intergenic
1186759183 X:12705378-12705400 ACTTTCCAATTGATATTAGCTGG + Intronic
1187940056 X:24372650-24372672 AACTTCCACTGGAAGTAAGAAGG + Intergenic
1188044982 X:25415368-25415390 AAGTTACACTGGAATTTAGAAGG + Intergenic
1193560380 X:83010531-83010553 AATATCATCAGGAAATTAGCAGG - Intergenic
1193709260 X:84859409-84859431 AATTTCCAGTGAAAAATAACTGG + Intergenic
1194039245 X:88919317-88919339 AAATTCTACTGGCAATGAGCAGG + Intergenic
1194631337 X:96288754-96288776 AATTTCTACTGGAAAGGAGGAGG - Intergenic
1194938660 X:99982542-99982564 AATTTTCACTGGAAATTCACTGG - Intergenic
1195050434 X:101091599-101091621 AATTCCCTCTGGAAATAGGCCGG - Intronic
1197619194 X:128728074-128728096 TGATTCCAATGGAAATTAGCGGG - Intergenic
1199211751 X:145220336-145220358 CATTTTCTCTGGAAATCAGCAGG - Intergenic
1199768438 X:150957807-150957829 CATTTCTACTCAAAATTAGCTGG + Intergenic
1200755088 Y:6983693-6983715 AATTTACACAGGAAATCAACAGG + Intronic
1201376378 Y:13325545-13325567 AATTTCCATTGGAATTTAAGTGG - Intronic
1201744485 Y:17356289-17356311 ATTTTTCACTCGAAATTTGCTGG - Intergenic