ID: 921660863

View in Genome Browser
Species Human (GRCh38)
Location 1:217800762-217800784
Sequence AATTAATTTTAGCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921660863_921660867 27 Left 921660863 1:217800762-217800784 CCTTCCACCTGCTAAAATTAATT 0: 1
1: 1
2: 2
3: 18
4: 254
Right 921660867 1:217800812-217800834 TCTGTCCTATTTCTTCTTATAGG 0: 1
1: 0
2: 4
3: 51
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921660863 Original CRISPR AATTAATTTTAGCAGGTGGA AGG (reversed) Intronic
901357706 1:8665672-8665694 ATTTAAGTAGAGCAGGTGGAAGG + Intronic
904949802 1:34227550-34227572 TATTAATTAGAACAGGTGGATGG + Intergenic
907058841 1:51399961-51399983 AAATAAGTTTATTAGGTGGAAGG - Intronic
908870571 1:68606364-68606386 AATGATATTTAGTAGGTGGATGG + Intergenic
909522513 1:76585900-76585922 AGTTGATTTTTGCAGGTGGCAGG - Intronic
909926969 1:81448849-81448871 AACTAATTTTACTAGGGGGATGG + Intronic
910018780 1:82559337-82559359 AATTTATTTTAATAGGGGGATGG + Intergenic
911225709 1:95303486-95303508 AATTAATTTTTGAATGTGAAGGG - Intergenic
915388243 1:155516885-155516907 AATAAATTTAAGGAGGTGAAAGG + Intronic
916777376 1:167981273-167981295 AATTAATTTTTGCATATGTAGGG + Intronic
917660755 1:177174762-177174784 AAATAATTTAACCAGGTGTATGG - Intronic
919061378 1:192638239-192638261 AAGTAATTTTGGAAGATGGAAGG - Intronic
919121465 1:193345872-193345894 AATTAATTGTATCAAGTGTATGG + Intergenic
919694364 1:200558828-200558850 AAGTAATGTTAGCTGGAGGATGG + Intronic
921660863 1:217800762-217800784 AATTAATTTTAGCAGGTGGAAGG - Intronic
1067229714 10:44397687-44397709 CATTCATTCTAGCAGCTGGATGG - Intergenic
1068003620 10:51366914-51366936 CATTAATTTTTGCAGGGGGTCGG - Intronic
1068289298 10:54981765-54981787 AATTAATTAAAGGAGGTGGGGGG - Intronic
1071855627 10:89621453-89621475 ATTTAATGTTAAGAGGTGGAAGG + Intronic
1074166746 10:110885666-110885688 ATATAATTTTAGCAGTTTGAGGG + Intronic
1075405336 10:122192062-122192084 AGTTAATTAGAGGAGGTGGATGG - Intronic
1075964538 10:126599718-126599740 AATTAATATTAACAATTGGAAGG - Intronic
1076387939 10:130072001-130072023 AATCAATTCTAGGAGGTGGGAGG - Intergenic
1076415890 10:130288234-130288256 AATGAACTGGAGCAGGTGGAAGG + Intergenic
1078393106 11:10953476-10953498 AATTTATTTTAGTATATGGAAGG - Intergenic
1081092707 11:38892490-38892512 AATTAATTAAAGAAGATGGAAGG - Intergenic
1081258524 11:40928654-40928676 AATTAAATTTAGCATTTGTACGG - Intronic
1082138908 11:48583538-48583560 AAGTAAATTTAGCAGGTTTATGG - Intergenic
1082215856 11:49568463-49568485 ATTTAATTTTATCAGTTGCATGG - Intergenic
1083252622 11:61478039-61478061 TTTTCCTTTTAGCAGGTGGAGGG - Intronic
1084150125 11:67284194-67284216 CAGTAACTTTACCAGGTGGATGG - Exonic
1086633724 11:89056009-89056031 ATTTAATTTTATCAGTTGCATGG + Intronic
1087925955 11:103918935-103918957 AATTAATTATAGGAGCTGAAGGG + Intronic
1088389938 11:109302958-109302980 AATAAATGTTAGGATGTGGATGG - Intergenic
1090903316 11:131051593-131051615 TATTAGTTGTTGCAGGTGGAGGG + Intergenic
1091270247 11:134305864-134305886 AATTAAATATAGAAGTTGGAAGG + Intronic
1091615571 12:2048609-2048631 AGGTAATTTTTGCAGGTGGGTGG + Intronic
1093081710 12:14819381-14819403 TAGTAATTTTAGCAGATGCAAGG - Intronic
1093743938 12:22718609-22718631 AATTTATTTTTGCCGGTGGGGGG + Intergenic
1094334330 12:29331325-29331347 TATAAATCTTAGCAAGTGGAGGG - Intronic
1095313387 12:40728144-40728166 CATTAATTTTAGCAGCTAGAAGG + Intronic
1095416291 12:41980616-41980638 AATAACTTTGGGCAGGTGGATGG - Intergenic
1095600154 12:44004107-44004129 AATTATTTATGGCAGGTGGCAGG - Intronic
1096705506 12:53419211-53419233 AATTAGTGTTAGTAGGTGAAAGG - Intergenic
1098957712 12:76704765-76704787 AATGAAGTTTAGGAGGTGGTGGG - Intergenic
1099013448 12:77319210-77319232 AATCAATTTAAGCAGCTGAAAGG + Intergenic
1099742539 12:86659389-86659411 AATTAATTTTTTTAGCTGGAGGG + Intronic
1099959172 12:89380372-89380394 ACATAATTTCAACAGGTGGAGGG - Intergenic
1099991813 12:89730475-89730497 AATTAATGGTAGCAGGGGGCAGG + Intergenic
1100022320 12:90084578-90084600 AATTAATGTTACCAGGGGAACGG - Intergenic
1100963964 12:99992268-99992290 AATGAGTCTTAGCAGGTGGTTGG - Intergenic
1101153742 12:101908013-101908035 CATTAATTTCAGCACCTGGAGGG + Intronic
1104509412 12:129362913-129362935 AATTAAAGTTAGAAGGTTGAAGG - Intronic
1104601733 12:130159308-130159330 AAATATTTTTTGGAGGTGGAGGG - Intergenic
1105014740 12:132779380-132779402 AATTAATTTTAAGATGTGGCAGG - Intronic
1106445067 13:29822204-29822226 ATTTACTTTTAGCTGGTGAAAGG + Intronic
1106776259 13:33012973-33012995 AATTAATTTTAAAAAGAGGAGGG + Intergenic
1108223926 13:48268059-48268081 AAGTAGTTTTAGCAGAGGGAAGG - Exonic
1108460268 13:50659221-50659243 AATTAATATTGGCAGGTCAAAGG + Intronic
1109734278 13:66461103-66461125 AATTTATTTTAGCATTTTGAAGG - Intronic
1109880928 13:68475346-68475368 AATTAATTTCAGCAGGTAATAGG + Intergenic
1111973068 13:94937523-94937545 AATCAATTTTTGTACGTGGAAGG + Intergenic
1112148005 13:96723123-96723145 CCTTAATTTTAGCTGGTGCATGG + Intronic
1112604905 13:100894807-100894829 AATTTCTTTTAGCTGGTGAATGG + Intergenic
1113394165 13:109929796-109929818 AATTAATATTACCACATGGATGG + Intergenic
1113443810 13:110350405-110350427 AATTTTTTTTAGCACTTGGAGGG + Intronic
1113549436 13:111181022-111181044 AATAAATTGGAGCAGGTGAATGG + Intronic
1113675576 13:112204763-112204785 ATCTATTTTTAGCAGGTGGTTGG + Intergenic
1116746022 14:48820174-48820196 AATTTATTTTAGCAGTTTGGGGG + Intergenic
1120280793 14:82435530-82435552 ATTTTATTTTAGCATTTGGAGGG + Intergenic
1120568605 14:86090298-86090320 AAATTATTTTAGTAGGTGGTAGG - Intergenic
1125088565 15:35762060-35762082 AATTAATTTCACCTGGAGGATGG - Intergenic
1127475798 15:59331679-59331701 AATGAAATTTAGATGGTGGAAGG - Intronic
1128175421 15:65551100-65551122 AATTAATTCCAACAGGTAGAGGG - Intronic
1129593508 15:76939318-76939340 AATAAATGGTAGCAGTTGGAGGG + Intronic
1129969581 15:79766370-79766392 AACTCATTGCAGCAGGTGGAAGG - Intergenic
1131287239 15:91070489-91070511 AATAAACTTTAACAGGAGGAAGG + Intergenic
1131698926 15:94910986-94911008 ACTTACTTTTATCAGTTGGATGG + Intergenic
1131813635 15:96200272-96200294 AATTAATTTTAATATGTTGATGG - Intergenic
1132079423 15:98852024-98852046 AATTAATCTTAAAAGGTGGAGGG + Intronic
1132810511 16:1794591-1794613 AAGTGGTTTGAGCAGGTGGAGGG - Intronic
1133850391 16:9498031-9498053 AATAAATATTAGCAGCAGGATGG - Intergenic
1133860544 16:9590895-9590917 AATAAAATTCAGCTGGTGGAAGG + Intergenic
1138800865 16:60027244-60027266 AATAAATTTTATCAGGAAGATGG + Intergenic
1138945750 16:61847585-61847607 AATTAATTATGGGAGGTGGGTGG + Intronic
1139191790 16:64872635-64872657 AATTATTTTTAGTATCTGGAAGG + Intergenic
1139770109 16:69267660-69267682 AATTAATTCTAGCCAGTGAAGGG - Intronic
1140205934 16:72933515-72933537 CATTAATTTCAGCAGCTGGGTGG - Intronic
1143229235 17:5337932-5337954 AATAATTTTTAGCAAATGGAAGG + Intronic
1144641273 17:16938349-16938371 AGATAATTTTAGGAGGTGCAGGG + Intronic
1150934848 17:69624058-69624080 ACGTAATTTTAGAAGGAGGATGG + Intergenic
1151133943 17:71926988-71927010 GATTATTTTCAGCAGATGGATGG - Intergenic
1153552700 18:6278802-6278824 AATTAATTTGAACACCTGGAAGG - Intronic
1155697936 18:28706049-28706071 AGTTAACTTTAGCAAGAGGAGGG + Intergenic
1155729253 18:29131821-29131843 GTTTGATTTTAGCAAGTGGATGG + Intergenic
1156552867 18:38036661-38036683 AGTTAATTTTAGCAGCAGGGAGG - Intergenic
1159750056 18:72289215-72289237 AGATAATTTTATCAAGTGGAAGG - Intergenic
1159934874 18:74356082-74356104 AAATAATTTCATCAGGTAGAAGG + Intronic
1163227296 19:15973190-15973212 GACTAAGTTTTGCAGGTGGAAGG - Intergenic
1168541355 19:57213165-57213187 AATTATTTTTAAAAGGAGGAGGG + Exonic
927285163 2:21349801-21349823 AATTAATCTTAGTAGTTTGAGGG + Intergenic
928992745 2:37252114-37252136 AATTATTTTAAGCAGTTTGAGGG - Exonic
930198141 2:48529554-48529576 AATCAATCATAGCAGGAGGAAGG - Intronic
931663437 2:64591473-64591495 AGGTAGTTTTAGCGGGTGGAGGG + Intronic
932717024 2:74108484-74108506 AGTTAATTTTAGTAGGAGGGAGG - Intergenic
932800323 2:74736396-74736418 AAGTAATTTAAGCAAATGGATGG - Intergenic
935892411 2:107693294-107693316 AATAAAATTTAACAGATGGAAGG - Intergenic
937198793 2:120183314-120183336 TAGCAATTTTGGCAGGTGGAGGG - Intergenic
938050310 2:128163725-128163747 AATTAATTTTAGAAGAGGCAGGG + Intronic
938749595 2:134315838-134315860 AGTTATTCTTAGCAGGTAGAGGG + Intronic
939057739 2:137383854-137383876 AATCAGTTTTAGCAGGTGTCAGG - Intronic
939169450 2:138677505-138677527 AATTAAATGAAGCAGGTGGAAGG + Intronic
940087559 2:149877862-149877884 TATTAATTTAAGAAAGTGGAAGG + Intergenic
940184678 2:150970456-150970478 AATTTTTTTTTGCTGGTGGAGGG + Intergenic
942177583 2:173349290-173349312 AATTAAATTTAGCAGTTTAATGG + Intergenic
942383955 2:175421806-175421828 AATTAATATATGCAGGTCGAGGG + Intergenic
942747584 2:179252790-179252812 AATTAAGTTTAAAAGGTGGCAGG - Intronic
942826252 2:180180441-180180463 AATTTTTTTTAGAAGGTGGGGGG - Intergenic
944503536 2:200386205-200386227 AATTATTTTTCCCAGGTGGAAGG - Intronic
945154107 2:206819681-206819703 AATTAGTTTATTCAGGTGGAAGG - Intergenic
945337344 2:208608280-208608302 AATTAATTGTACCAGATGGCAGG - Intronic
946614806 2:221497939-221497961 ATTTGATTTTAGCATATGGATGG - Intronic
1169997977 20:11580138-11580160 AATTAATTTTAGCAGCTTCTGGG + Intergenic
1171334282 20:24369764-24369786 TATTTATGTTAGCAGGTGGTGGG - Intergenic
1172566535 20:35934932-35934954 AATTAAATGAAGTAGGTGGATGG + Intronic
1175263772 20:57690540-57690562 AATTAACTGTAGCAGGAGGCGGG + Intronic
1177030280 21:15974391-15974413 GATTAGTTGTAGCAAGTGGAGGG - Intergenic
1177142531 21:17373161-17373183 AAATAATCGTAGCATGTGGAAGG + Intergenic
1177994527 21:28080428-28080450 AATTAATCTAAGTAGGTAGATGG - Intergenic
1178574448 21:33772534-33772556 AATTAATGATAGGAGCTGGAGGG - Intronic
1182171794 22:28237754-28237776 AAGGAATTTTTTCAGGTGGAGGG - Intronic
1182331718 22:29555706-29555728 AACTACTTCTAGCAGGGGGAGGG + Exonic
1182382575 22:29904769-29904791 AGTTGATTTTAGCAGGAAGATGG + Intronic
1184440606 22:44510897-44510919 AATCAATTTTGGCAGGGGGGAGG - Intergenic
1184882815 22:47322019-47322041 TATTAATTTTGGCTGCTGGATGG - Intergenic
951041231 3:17990783-17990805 ATTTAAATTATGCAGGTGGAGGG + Intronic
951161471 3:19427873-19427895 AATTCCTATTTGCAGGTGGAAGG + Intronic
951608267 3:24461899-24461921 AATTATTTTTAATAGGTGCATGG - Intronic
952414589 3:33079411-33079433 TATTTATTTTAGCAAGAGGAGGG + Intronic
954011974 3:47648773-47648795 AAATAATTTTAGCATTTGGTGGG - Intronic
955720293 3:61873297-61873319 CATTCATTTTAGCAGTTGCATGG - Intronic
956030829 3:65035767-65035789 AATTTATTTTAGCAAGAGGTAGG - Intergenic
957199787 3:77118380-77118402 AATTCATTTGAGCAGTTGTAGGG + Intronic
957243849 3:77693406-77693428 AATTAATATTTGCAGGTGCTGGG - Intergenic
957642772 3:82879310-82879332 AAGGAAATGTAGCAGGTGGAAGG + Intergenic
958417637 3:93893418-93893440 TATTAATTTCAGCATTTGGAAGG - Intronic
958434933 3:94084640-94084662 ATTTAATTCTAGCAGGTGATTGG + Intronic
959339875 3:105115343-105115365 AATAAACTTTAGGAGGTGGAAGG - Intergenic
959794510 3:110408487-110408509 TATCAATTTTAACAGGTGTAAGG + Intergenic
960369848 3:116821543-116821565 TATTGAATTTAGCAGATGGAGGG - Intronic
960766703 3:121138191-121138213 AATAAATTTAAGGAGGTGAAAGG + Intronic
961096263 3:124159172-124159194 ACTGAATTTGAGCAGATGGAGGG - Intronic
961399944 3:126632720-126632742 CATTAATATTAGCATGTGAATGG - Intronic
961471071 3:127113165-127113187 ACTGAATTTAAGCAAGTGGAGGG - Intergenic
961727387 3:128941195-128941217 AATTAGTTTTTGTAGGTAGATGG + Intronic
961857593 3:129888152-129888174 AATTAATTCTGGCAGATGGTGGG + Intronic
962122234 3:132574074-132574096 CATTAACTTTAAAAGGTGGAAGG + Intronic
962217725 3:133537124-133537146 TATTATTTTCATCAGGTGGATGG - Intergenic
962682350 3:137813421-137813443 ACTTAATTTTAGATGCTGGAAGG - Intergenic
964463286 3:156960996-156961018 ATTTTATTCTAGCAGGTGGAAGG - Intronic
965143317 3:164866519-164866541 AATAAATTTTAGCAGGTGGAAGG - Intergenic
965272403 3:166635642-166635664 AAATATTTGGAGCAGGTGGATGG + Intergenic
967419845 3:189260799-189260821 ACTTAGTGTCAGCAGGTGGAGGG + Intronic
967634231 3:191781770-191781792 AATAAATTTTAGCAAGTAGATGG - Intergenic
967697760 3:192553449-192553471 ATTTATTTTTAGCAGTTGTATGG - Intronic
969431874 4:7160042-7160064 AATTAATGTTATCTGGTGCATGG - Intergenic
969660923 4:8527060-8527082 TATGAATTTTAACAGGTGTATGG + Intergenic
970621902 4:17830798-17830820 AGTCCCTTTTAGCAGGTGGAGGG + Intronic
970737203 4:19186622-19186644 TTTTAAATTTAGCAGGTGAAAGG - Intergenic
971052813 4:22880218-22880240 AAATAAAATTAGCAAGTGGATGG - Intergenic
971056813 4:22922552-22922574 AAGTCATTTTGGCAGGTAGAGGG + Intergenic
971809373 4:31404164-31404186 AATTAATTTTGGGAGAAGGAAGG + Intergenic
974800842 4:66815754-66815776 AATTAAGTTTATCAGGAGTAAGG + Intergenic
975904017 4:79188235-79188257 AATTAATTTTATCAGGGGCAGGG + Intergenic
976031022 4:80753864-80753886 GGGTAATTTTAGCAGGAGGAAGG - Intronic
977484925 4:97632937-97632959 AATTATATTTAGAAGGGGGATGG + Intronic
977819440 4:101455018-101455040 AATTAATTTTACAAGGTGTAAGG + Intronic
978415567 4:108472278-108472300 AATTTTCTTTAGCAGGTGAATGG + Intergenic
979229729 4:118334267-118334289 AATAGATTATAGAAGGTGGAAGG + Intronic
979418847 4:120478314-120478336 AATTAATTTTTGTAGGTGTAAGG - Intergenic
979544805 4:121927816-121927838 TATTAATTTTATCAGTTGCATGG - Intronic
979688396 4:123536914-123536936 AGTTAATTTTAGCAGGTGAATGG - Intergenic
981400163 4:144304318-144304340 ATTTTATTTTTGCAGGTGGAGGG - Intergenic
981930359 4:150182927-150182949 ATTTAATTTCAGCAGGAGGTAGG + Intronic
981992283 4:150936371-150936393 AATCAATTTTAGCAGTAGAAAGG + Intronic
983366380 4:166795611-166795633 AATTAATTTCAGAAAGTGTATGG - Intronic
983819450 4:172174478-172174500 AAGTAATTTTGGAAAGTGGAGGG - Intronic
984726099 4:183022730-183022752 AATTATTTTTAGCATGTTAATGG - Intergenic
984972176 4:185201524-185201546 AATTTTTTTTTGCTGGTGGAGGG - Intronic
985926513 5:3023673-3023695 AATTACTTTTAACAAGTGCAAGG + Intergenic
986511206 5:8508112-8508134 AAATAGTATTAGCAGGTTGATGG + Intergenic
987272890 5:16330663-16330685 AATTAATTTTATCAGGGATAAGG + Intergenic
989201676 5:38770205-38770227 AATCACTTTTGGGAGGTGGATGG + Intergenic
990125055 5:52505548-52505570 AATTAAGTTTATCATGTGGAAGG - Intergenic
992143061 5:73818818-73818840 CATTAATCTCTGCAGGTGGAAGG + Intronic
992417231 5:76563282-76563304 ATTTAAATTTAGAAGGAGGAGGG + Intronic
992547668 5:77830682-77830704 AATTAATTTCAGCATGTTAAAGG + Intronic
993558603 5:89374519-89374541 AATGAATTTTAGAAGGTGACAGG + Intergenic
994063962 5:95513807-95513829 AATTTATTTTAGCAGGTAACTGG - Intronic
994155125 5:96494770-96494792 AAATGATTTTAGCAGGTGGATGG + Intergenic
996161293 5:120169425-120169447 AAGTAATTTTATCAGGTTGCAGG - Intergenic
999670062 5:153951803-153951825 GATTTATTTTAGCAAGTAGATGG - Intergenic
1002761649 6:207013-207035 AATTAATTTTAAGAGGCGAAAGG - Intergenic
1006514609 6:34538962-34538984 AATTAATATGAGATGGTGGAGGG + Intronic
1008801871 6:55378367-55378389 ATCTTATTTTAGCAGGTTGATGG - Intronic
1011737189 6:90322880-90322902 AATTTTTTTTTGCTGGTGGAGGG + Intergenic
1012226681 6:96711937-96711959 AATTAATTATAGCAACTGGCTGG - Intergenic
1012614768 6:101263182-101263204 AATAAATTTTATCAAGTAGATGG - Intergenic
1013529790 6:111008585-111008607 AATTAAATTTAGAAAGTTGAGGG + Intronic
1014510393 6:122314033-122314055 AATATATTTCAGCAGGTTGAAGG + Intergenic
1015688513 6:135894003-135894025 AATTAATTTTTGGAAGTGGGTGG - Intronic
1016003172 6:139062964-139062986 AAATAATTTTAGGAGGTGCATGG - Intergenic
1017271176 6:152507842-152507864 AATTAGTTTTAGCAATTAGAGGG + Intronic
1018020139 6:159754791-159754813 AATTCATTGTTGCATGTGGAGGG + Intronic
1021442704 7:20696165-20696187 AATTTATATCAACAGGTGGATGG + Intronic
1021607910 7:22427685-22427707 AATTAATGTAAGCAAGTAGAAGG + Intronic
1021790527 7:24200272-24200294 AATCAATTTAGGCAGCTGGATGG - Intergenic
1024726709 7:52205586-52205608 AAGAAATTTTATCAAGTGGAAGG - Intergenic
1025214342 7:57043260-57043282 AGATAATTTTAGCAGATGCATGG - Intergenic
1025657611 7:63533553-63533575 AGATAATTTTAGCAGATGCATGG + Intergenic
1028267574 7:88746033-88746055 AAATAGTTTTACCAGGTAGAAGG + Intergenic
1029242743 7:99175863-99175885 AATCAATATGACCAGGTGGATGG - Intronic
1029538482 7:101169577-101169599 CATTCCTTTTACCAGGTGGAGGG + Intergenic
1030565764 7:111153283-111153305 AATTAACTTTAGTAGGTATAAGG - Intronic
1031318640 7:120291239-120291261 ATATAATTTTAGCAGGAAGATGG + Intronic
1032360151 7:131247711-131247733 AAATAATTTTAACAGCTGTAAGG - Intronic
1033786976 7:144743713-144743735 AATTAATTTTATCATGGGGTAGG + Intronic
1034278778 7:149837510-149837532 AAATAATTTTGTGAGGTGGAAGG - Intergenic
1034827295 7:154277461-154277483 AATAAATTTTAAAAGATGGAAGG + Intronic
1035410193 7:158633737-158633759 AATTAATTTTAGATTTTGGAGGG - Intronic
1035528170 8:330903-330925 AATTAATTTTTGCAGCATGATGG + Intergenic
1036029611 8:4954020-4954042 AATTCTTTTTAACAGGTGGGTGG - Intronic
1037121041 8:15287246-15287268 ATTTCGTTTTAGCAGCTGGAAGG + Intergenic
1038625842 8:29192746-29192768 AGTTAATTTTAGCTGGGTGATGG - Intronic
1040642048 8:49346377-49346399 AAGTATTTTTAGCAGGTGGCTGG + Intergenic
1040889705 8:52304427-52304449 TATTAATTTAAGCAGTTAGATGG + Intronic
1042000197 8:64113747-64113769 AATTAATTTTAAAAGCTTGATGG - Intergenic
1042206895 8:66338540-66338562 AATAAATGTCAGCAGGTGTAGGG - Intergenic
1042795580 8:72659738-72659760 AATGAGTTTTTGCTGGTGGAGGG - Intronic
1043028479 8:75102152-75102174 AATTATATTTAGAAGTTGGAAGG - Intergenic
1043459691 8:80446889-80446911 ATTTTATTTTGGCAGGTAGAAGG + Intergenic
1043595750 8:81882683-81882705 GATTAATTTTAGCATGTACATGG + Intergenic
1043860523 8:85311033-85311055 AATTACTTTTTTCAGGTAGAGGG + Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1044777574 8:95707800-95707822 AATTAATTTGAGTTGGAGGATGG - Intergenic
1046744662 8:117863981-117864003 AATGAATTGTAGCAGGTGACAGG - Intronic
1047321547 8:123789999-123790021 AATTTATTTAAGTAGCTGGATGG + Intronic
1048099735 8:131337500-131337522 AATTCATGCTAGAAGGTGGAAGG - Intergenic
1050542296 9:6681069-6681091 AAGAGATTTGAGCAGGTGGAAGG - Intergenic
1051004879 9:12331559-12331581 AATTGAATTTAGAAGGTGGCAGG + Intergenic
1051705215 9:19872030-19872052 AATTAATTTTAGTAACTAGATGG + Intergenic
1052086008 9:24266903-24266925 AATTAATGTTAACAGGATGAGGG + Intergenic
1052122475 9:24735123-24735145 AATTTTTTTTAGCATGTTGAAGG + Intergenic
1056728945 9:89147402-89147424 AATTCAGTTTGGCAGGAGGATGG - Intronic
1057642632 9:96839663-96839685 AATAAAATTTAGCAGGTGGGGGG - Intronic
1058622668 9:106899773-106899795 AAGGAATTTAAGCAGGTGGAGGG - Intronic
1059548896 9:115207601-115207623 AAATAATTTTAGCTGGTGCATGG - Intronic
1061746650 9:132745121-132745143 CGTTAATTTCAGCAGATGGAAGG - Intronic
1062672874 9:137722072-137722094 AATTTATTTTTGCCTGTGGATGG + Intronic
1188013840 X:25086069-25086091 ATTTATTTTTAGGGGGTGGAGGG + Intergenic
1188661440 X:32764395-32764417 AGATAATTTTTGGAGGTGGATGG - Intronic
1189047497 X:37609194-37609216 ATTTCTTTTTAGCAGGTGGAAGG - Intronic
1189146852 X:38664392-38664414 ATTTGATTTTAGCAGGTAAAAGG + Intronic
1190230653 X:48579447-48579469 AATTTGCTTTGGCAGGTGGATGG + Intergenic
1190436330 X:50429342-50429364 AATAAAGTTTGGCAGGGGGATGG - Intronic
1191647923 X:63504043-63504065 AATTGATTTTAGCTTGTGGTAGG - Intergenic
1192188745 X:68977981-68978003 AAGCAACTTTAGAAGGTGGAAGG - Intergenic
1192421621 X:71037534-71037556 CATTGATTTTAACAGGTGCATGG - Intergenic
1193654783 X:84186795-84186817 AACTATTTTTAGGAGGTGTATGG + Intronic
1194904129 X:99552657-99552679 AATGTATATTAGCAGGTGAATGG - Intergenic
1195438120 X:104868688-104868710 AATTAATCTTTGCAAGGGGAAGG + Intronic
1195500642 X:105594514-105594536 AGTTAATTTTAGCATCTGGTAGG + Intronic
1195532058 X:105968775-105968797 AATGAAATTTAGAGGGTGGAGGG + Intergenic
1202017608 Y:20427776-20427798 AAGCAATTTTAGCTGGTGTATGG - Intergenic
1202177370 Y:22110166-22110188 TATTTATTTTTGCAGGGGGAGGG + Intergenic
1202213991 Y:22476218-22476240 TATTTATTTTTGCAGGGGGAGGG - Intergenic