ID: 921664050

View in Genome Browser
Species Human (GRCh38)
Location 1:217845367-217845389
Sequence CTTTCTAGGCTCCAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921664043_921664050 30 Left 921664043 1:217845314-217845336 CCAACATAGAAGGCCTGTGGTTT 0: 1
1: 1
2: 0
3: 14
4: 218
Right 921664050 1:217845367-217845389 CTTTCTAGGCTCCAGGTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 203
921664044_921664050 17 Left 921664044 1:217845327-217845349 CCTGTGGTTTTAGTGCTTCTGTC 0: 1
1: 0
2: 0
3: 15
4: 205
Right 921664050 1:217845367-217845389 CTTTCTAGGCTCCAGGTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921664050 Original CRISPR CTTTCTAGGCTCCAGGTGGA AGG Intronic
900239298 1:1607023-1607045 AATTCTCTGCTCCAGGTGGAGGG - Intergenic
900566665 1:3335720-3335742 CTTTCTGGCATCCTGGTGGAAGG + Intronic
907461892 1:54610072-54610094 AGTTTTGGGCTCCAGGTGGATGG + Intronic
910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG + Intergenic
911530284 1:99036221-99036243 TTTTACAGGCTCAAGGTGGAAGG - Intergenic
911540127 1:99147419-99147441 TTTTCTAGTTTCCAGGAGGAGGG + Intergenic
911728203 1:101264693-101264715 TTTTCTAGGCTCAAAATGGATGG - Intergenic
915592675 1:156879498-156879520 CCTCCTCGGCTCCTGGTGGAGGG + Intronic
915717778 1:157960750-157960772 CTTTCTAACCTCTAGGTGGGAGG - Intergenic
916642962 1:166751013-166751035 GTTTCTGGGCTCCAGCTGGCTGG + Intergenic
920190883 1:204193028-204193050 CTTTGGAGGCTCCTGGTAGAGGG + Intronic
920403841 1:205694153-205694175 CTCTCTGGGCTCCAGGAGGCTGG + Intergenic
920659322 1:207902012-207902034 CGTTCTTGGCCCCAGGTTGATGG - Intronic
920949774 1:210561524-210561546 CCTTCTAGGCACCAGGCAGATGG - Intronic
921664050 1:217845367-217845389 CTTTCTAGGCTCCAGGTGGAAGG + Intronic
923066977 1:230527197-230527219 CTTGCTGGGCTCCATGTGGGTGG + Intergenic
923918059 1:238530595-238530617 CTTTCAAGGCTGCAGGGGCAGGG + Intergenic
924637609 1:245803590-245803612 CTTTTTAGCCTCCACGTGGCTGG - Intronic
1062970605 10:1645375-1645397 CTGTGCAGGCTCCAGGTCGATGG - Intronic
1065973107 10:30820625-30820647 CTTTCGAGGCTGGAGGTTGAAGG - Intronic
1066057413 10:31695146-31695168 CTTTCTTGGCTTCATTTGGAGGG - Intergenic
1067145609 10:43691641-43691663 CTTCCTAGCTTCCAGATGGATGG - Intergenic
1067236386 10:44454117-44454139 CTTTCTGGGCTCCATGGGGTTGG + Intergenic
1070572201 10:77648936-77648958 CAGTCTAGGCTTCAGATGGAGGG - Intergenic
1070602193 10:77873656-77873678 CTTTACAAGCTCCAGGTGAATGG - Intronic
1074222097 10:111447976-111447998 CTTTGGAGACTCAAGGTGGAAGG - Intergenic
1074792934 10:116910125-116910147 GTTTATAGGCTCCAGGTGACAGG + Intronic
1075442395 10:122490556-122490578 TTTTCTAGACTTCAGATGGAGGG + Intronic
1075745679 10:124725658-124725680 GTATCTGGGTTCCAGGTGGAGGG + Intronic
1084455666 11:69266816-69266838 CTTTCTCTGCACCAGGTGCAGGG - Intergenic
1086348860 11:85924824-85924846 CTTGCTGGGCTCCATGGGGATGG - Intergenic
1086608437 11:88725098-88725120 CTTGCTGGGCTCCATGAGGATGG - Intronic
1090080095 11:123606594-123606616 CTGTCTTGGCTCCAGTTTGATGG + Exonic
1090128760 11:124117537-124117559 CTTACCTGGCTCCCGGTGGAGGG - Exonic
1090662889 11:128894350-128894372 CTATTTAGGCTGGAGGTGGAAGG + Intronic
1091584133 12:1806283-1806305 CTTTCTAGGCCCCACATCGAGGG + Intronic
1092398801 12:8153812-8153834 CTTGCTAGGCTCCATGGGGTTGG + Intronic
1094478211 12:30858877-30858899 CATTCTAGGGTCCAGGGGCAAGG - Intergenic
1094713130 12:32985527-32985549 CTTTCTAGGCTCCAGCTTTGTGG + Intergenic
1096648760 12:53051841-53051863 TTTCCTAGGCTGAAGGTGGAGGG - Exonic
1097017379 12:55997149-55997171 CTGTCTCGGCTCCAGGAGGCGGG + Intergenic
1097080053 12:56423273-56423295 CTTTGTAGGCTCCAGCAGCAGGG + Exonic
1100855116 12:98751143-98751165 CTCTGGAGGCTCCAGGTTGAGGG + Intronic
1103523624 12:121552722-121552744 CTTCCTAGGGTCCATGGGGAGGG - Intronic
1103746805 12:123130454-123130476 CCTTCTTGGCTCCAAGGGGAAGG + Intronic
1105737397 13:23285535-23285557 CTTACTAGGCTCCATGGGGATGG + Intronic
1107648157 13:42516496-42516518 CTTGCTGGGCTCCAGGGGGTGGG - Intergenic
1110690028 13:78422157-78422179 CTTGCTAGACTCATGGTGGAGGG + Intergenic
1112492831 13:99882890-99882912 CTTTCTGGGCGCCAGGGGAAGGG - Intronic
1114710054 14:24768667-24768689 TTTTCTGGGCTCCATGGGGATGG - Intergenic
1119661274 14:76453716-76453738 CTTTGGAGGCTCAAGGTGGGAGG - Intronic
1119906489 14:78307980-78308002 TTTTCAAAGCTCCAGGTGGAAGG - Intronic
1120960133 14:90116914-90116936 ATTTCAAGACCCCAGGTGGATGG + Intronic
1121793199 14:96714225-96714247 CTTTGGAGGTTCCAGGCGGATGG - Intergenic
1122289126 14:100670329-100670351 CATTCTGGGTTCCAGGTGGGTGG - Intergenic
1123062875 14:105602095-105602117 CTCTCTGGGCTCATGGTGGATGG + Intergenic
1123539052 15:21269235-21269257 CTTTGTAAGGCCCAGGTGGATGG + Intergenic
1123578628 15:21696495-21696517 CTTTCTTGGGTCAAGGTGGCAGG + Intergenic
1123615255 15:22138977-22138999 CTTTCTTGGGTCAAGGTGGCAGG + Intergenic
1124888116 15:33706070-33706092 CTTTCTAGCCTCCAGGGAAATGG + Intronic
1125439913 15:39690846-39690868 CTTTCTAGGCTCATGAAGGAGGG - Intronic
1125488407 15:40128214-40128236 CTTTCTAATATCCAGGTGGGGGG + Intergenic
1125488930 15:40132111-40132133 CTTTCTAATATCCAGGTGGGGGG + Intergenic
1126815092 15:52446628-52446650 TTTTCTAGGCTGAAGGTGCAAGG - Intronic
1127065041 15:55228380-55228402 CTTCCTGTGCTCCAGGTGCAAGG - Intronic
1127547638 15:60005304-60005326 CTTGCTGGGCGCCAGGTGGTCGG - Exonic
1127666811 15:61155854-61155876 CTTGCCACACTCCAGGTGGAAGG + Intronic
1127707335 15:61560296-61560318 CTTTCTTACCTCCAGGTGGGAGG + Intergenic
1128646542 15:69382860-69382882 TTTTCTATGATCCTGGTGGAGGG + Intronic
1128700353 15:69799491-69799513 CGTGCCAGGCTCCAGGTGGAGGG - Intergenic
1130885391 15:88088424-88088446 CATTCTGGTGTCCAGGTGGAAGG - Intronic
1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG + Intronic
1131952235 15:97693312-97693334 CCGTCTGGGCTCCAGGAGGAGGG - Intergenic
1202987498 15_KI270727v1_random:430740-430762 CTTTCTTGGGTCAAGGTGGCAGG + Intergenic
1133057061 16:3150557-3150579 CTTCCGAGGCTCCCGGTGGGCGG - Intergenic
1134246726 16:12545664-12545686 GCTTCTAGGCTCCAGGTTAAGGG + Intronic
1134571991 16:15298983-15299005 CCTGCTAACCTCCAGGTGGAAGG - Intergenic
1134730390 16:16457060-16457082 CCTGCTAACCTCCAGGTGGAAGG + Intergenic
1134937041 16:18254836-18254858 CCTGCTAACCTCCAGGTGGAAGG - Intergenic
1136724874 16:32349192-32349214 CTTCCTAGGCCCCACGTGGTGGG - Intergenic
1138603018 16:58068720-58068742 CTTTGTGGGACCCAGGTGGATGG + Intergenic
1138843666 16:60539200-60539222 CTTGCTGGGCTCCATGTGGGTGG + Intergenic
1139145762 16:64323267-64323289 CTATCTAGGCTCCTTGTAGAAGG + Intergenic
1139193364 16:64890715-64890737 CTTGATAGACTCAAGGTGGAGGG - Intergenic
1140739290 16:77926847-77926869 CTTTCTAGGTCACATGTGGAAGG - Intronic
1203001556 16_KI270728v1_random:168563-168585 CTTCCTAGGCCCCACGTGGTGGG + Intergenic
1142740721 17:1930496-1930518 GTTTCTAAGCTCCAGGAGGGTGG - Intergenic
1143614601 17:8042354-8042376 CTCTCTACCCTCCAGGTGGAAGG + Exonic
1143621225 17:8081138-8081160 TTTTCTGTGCTCCAGGAGGACGG + Exonic
1145116767 17:20217570-20217592 GTTTCTAGACTCCAGGTGACAGG + Intronic
1148538058 17:48457186-48457208 CTTTCTGGGTTGCAGGTGCAGGG + Intergenic
1150872547 17:68929513-68929535 ATTTTTAGGCTATAGGTGGATGG + Intronic
1151195172 17:72426063-72426085 CTCTCAAGGCTCTAGCTGGAAGG + Intergenic
1151255929 17:72876564-72876586 CTATCTAGGCACTAGGTGGTTGG - Intronic
1151398436 17:73840314-73840336 CTTTCTTTCTTCCAGGTGGAGGG + Intergenic
1156545718 18:37961811-37961833 CCTTCTAGGCTTAAGGTGAAGGG - Intergenic
1157273612 18:46294761-46294783 CTTTCTTGGCTCCAGGAGTGGGG - Intergenic
1164221717 19:23200783-23200805 CTTTGTGAGCTCCAGGTGGGTGG + Intergenic
1164557580 19:29265601-29265623 CTCTCCAGGCTCCAGGAGGAAGG - Intergenic
1164975008 19:32566406-32566428 CTTTCTGGGCTCAAGGAGCATGG - Intergenic
1167616262 19:50535867-50535889 CTCTCTGGGCTCCTGGTGGTGGG - Intronic
1168105275 19:54162409-54162431 CTTTCAGGACTCCACGTGGAGGG + Intronic
925111186 2:1339553-1339575 TTTTCCAGACTCCAGGAGGAGGG + Intronic
926042656 2:9686499-9686521 CCTTCTAGGCACCAGGTTCAAGG - Intergenic
929544925 2:42849456-42849478 ATGTCTAGCTTCCAGGTGGAGGG + Intergenic
930734572 2:54763677-54763699 CCTTTTAGGCTCCTGGTAGAAGG - Intronic
938982810 2:136542635-136542657 CGTTCTAGACAGCAGGTGGAAGG + Intergenic
941396301 2:164977913-164977935 CTTTGTAAGGCCCAGGTGGATGG + Intergenic
941863881 2:170313588-170313610 GATTCTAGGGTCCAGGTGGCTGG - Intronic
943014497 2:182494785-182494807 CTTACTAGGCTCCAGGGGAAAGG + Intronic
943085010 2:183300730-183300752 CTTGCTGGGCTCCAGGAGGATGG + Intergenic
943347797 2:186760798-186760820 CATTCTAGACCCCAGGTTGAAGG + Intronic
944900939 2:204215358-204215380 CATTCTAGCCTCCAAGTTGATGG - Intergenic
945129530 2:206554667-206554689 CCTTCTAGTCTCTAGGTTGAGGG - Intronic
946189786 2:218002202-218002224 CTCTCTTGGCTCCAGGTTCAGGG - Intronic
947708530 2:232295415-232295437 CTTTCTTGGCTGCAAGAGGAAGG - Intronic
948395614 2:237642856-237642878 GATTCTAGGCTCCAGGTTGCAGG + Intronic
1169557338 20:6765424-6765446 CATTCTAAGTTGCAGGTGGAAGG + Intergenic
1170885122 20:20334019-20334041 CTTTCTCTGCTCCAAGTGCATGG - Intronic
1171148862 20:22809521-22809543 CTCTCCAGGCTGCAGGTGGGTGG - Intergenic
1174503748 20:51003823-51003845 CTTTCACGGCTGCAGGCGGAGGG + Exonic
1174723481 20:52838046-52838068 ATTTCTAGAATTCAGGTGGAAGG - Intergenic
1175148927 20:56917648-56917670 CTTTGCAGGCTACAGGTGGCTGG - Intergenic
1175299410 20:57932375-57932397 CTCTCCAGGCTCCAGGAGAAGGG + Intergenic
1176702999 21:10080765-10080787 CATTTTAGCCTCCAGGTGGTGGG + Intergenic
1177136368 21:17308831-17308853 CTTGCTGGGCTCCATGTGGGTGG - Intergenic
1177626823 21:23672777-23672799 TATTCTAGGACCCAGGTGGAAGG - Intergenic
1178121482 21:29474259-29474281 CTCACTAGGCTCCAGGTGAGGGG - Intronic
1179647683 21:42785248-42785270 CTGTCTGGGGTCCAGGTAGAAGG - Intergenic
1180924710 22:19545503-19545525 CATGCTGGGCTCCAGGGGGACGG + Intergenic
1182434101 22:30319198-30319220 CTTTCTAGGCTCCTGCAGGTGGG + Intronic
949175960 3:1063122-1063144 CTTTCTGGGCTCCATGGGGGTGG + Intergenic
949423541 3:3891548-3891570 CTTGCTAGGCTCCATGGGGATGG + Intronic
949599300 3:5580962-5580984 CTCTCTAGGCTGCAGGGGCAAGG - Intergenic
951415141 3:22414467-22414489 CTTCCTGGGCTCCATGTGGGTGG + Intergenic
951693480 3:25421248-25421270 CATTTCAGGCTGCAGGTGGAGGG - Intronic
954390730 3:50266873-50266895 CTTTCTAGGTTGGAGGTGGGAGG - Intergenic
955112858 3:55966326-55966348 CTTTCTAGTTTCCACCTGGATGG + Intronic
956300240 3:67764400-67764422 CTTGCTAGGCTCCATGGGGGTGG + Intergenic
957597176 3:82281963-82281985 CTTCCTATGCTCCAGGTTTAGGG - Intergenic
960226920 3:115179536-115179558 CTTACTGGGCTCCATGTGGTTGG + Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961577450 3:127849424-127849446 CCTTCTATGCTCCAGATGAAAGG + Intergenic
962961112 3:140311822-140311844 GATCCTGGGCTCCAGGTGGATGG + Intronic
964904824 3:161707303-161707325 CTTTCTGGGCTCCATGGGGATGG - Intergenic
966046945 3:175563783-175563805 ATTTCTTTGCTCCAGGTGTAAGG - Intronic
966493710 3:180556505-180556527 CTTTCTGGGCTCCATGGGGGTGG - Intergenic
968729032 4:2261215-2261237 CTGTCTAGGCTCCTGGGGGCGGG + Intronic
968735149 4:2291426-2291448 CCTTCTAGGCTCCCCGAGGAGGG + Intronic
970209860 4:13697877-13697899 ATTTTTAGGATCTAGGTGGAGGG + Intergenic
970291153 4:14573704-14573726 GTTTCCAGGCTCAAGGTGAAAGG - Intergenic
971382462 4:26111314-26111336 CTCACTAGGTTCCAGGTGAAGGG + Intergenic
971452076 4:26809737-26809759 CCTTCTAGGCCCCAAGAGGAGGG - Intergenic
973646539 4:52956255-52956277 CCTTCCAGGCTCCAAGGGGAAGG - Intronic
974619857 4:64340858-64340880 CTTTATGGGCTTCAGATGGAAGG - Intronic
974880996 4:67757101-67757123 CTATCTAGGCCCGAGGTGCAGGG + Intergenic
980283771 4:130756200-130756222 CTCTCTTTTCTCCAGGTGGATGG + Intergenic
980375194 4:131937139-131937161 CATTTTAGCCTCCAGGTGGTGGG + Intergenic
980480873 4:133385490-133385512 CTTGCAAGGCTGCAGCTGGAGGG - Intergenic
980871310 4:138614233-138614255 CTTTCTCTGCTCCAGGAGGAAGG + Intergenic
986092069 5:4519437-4519459 CAGTCAGGGCTCCAGGTGGAGGG - Intergenic
986691205 5:10315409-10315431 CTTTCCAGGATCCATGTGGCTGG + Intergenic
990181602 5:53166652-53166674 CTTTCTGGACTCCAGGAAGATGG + Intergenic
990183780 5:53191261-53191283 CTTGCTGGGCTCCATGTGGGTGG + Intergenic
999839776 5:155412773-155412795 TTTACTAGTCTCCAGGTGTAGGG - Intergenic
1002479902 5:179493154-179493176 CCTCCTAGGCTCTAGGTGTAAGG - Intergenic
1003547173 6:7069279-7069301 TTTTCTAGGGTATAGGTGGAAGG + Intergenic
1004588996 6:17030716-17030738 CTTTCTGGTGTGCAGGTGGAAGG + Intergenic
1012492633 6:99799427-99799449 CTTTCTGAGGTCCAGGTGGAAGG + Intergenic
1012548657 6:100448471-100448493 CTTTCTGGACTCCAGGTGGGTGG - Exonic
1015623410 6:135156262-135156284 CTTGCTGGGCTCCATGGGGATGG + Intergenic
1015802063 6:137070347-137070369 CTTGCTGGGCTCCATGGGGATGG - Intergenic
1016014183 6:139166914-139166936 CTTGTGAGGCTCCAGATGGATGG - Exonic
1020689049 7:11331878-11331900 CTTTCTAGAGTCCAAGTTGAAGG + Intergenic
1024998540 7:55294840-55294862 CTTTCTGGGCTCCATGGGGGTGG + Intergenic
1026431641 7:70353462-70353484 CTTTCTAGTCTCCTGCAGGAGGG + Intronic
1026849799 7:73717594-73717616 CTTTCTAGCAGACAGGTGGACGG - Intronic
1029846233 7:103414866-103414888 CTTACTTGACTACAGGTGGAGGG + Intronic
1033225703 7:139560533-139560555 GTTGCTAGGCACCGGGTGGAGGG + Intergenic
1036773504 8:11594285-11594307 CTTTCAAGGCTGCTGATGGATGG + Intergenic
1041900643 8:62978642-62978664 CTTTCTGGGCTCCATGGGGGTGG + Exonic
1042110914 8:65380150-65380172 CTTGCTGGGCTCCATGTGGGTGG - Intergenic
1042817326 8:72891937-72891959 TTTGATAGGCTCCAAGTGGAGGG + Intronic
1045844052 8:106612887-106612909 CTTTCTAGCCTTGAGGTGTAGGG - Intronic
1047976012 8:130131518-130131540 CTTTCTGGGGTCGAGGTGGGAGG + Intronic
1049046667 8:140157406-140157428 CTTTCTGTGGACCAGGTGGAGGG + Intronic
1049048362 8:140171015-140171037 ATTCTTAGGCTCCAGGTGGCAGG - Intronic
1051388481 9:16537980-16538002 TTTTCAAGGCACCAGATGGAAGG - Intronic
1052746679 9:32448450-32448472 CTTTCTGGGCTCCTTGTGGGTGG + Intronic
1055689738 9:78816613-78816635 CTTTCTAGTCCCCAGGTGTCAGG + Intergenic
1058034595 9:100237284-100237306 CTTTCTGGGCTCCAGGGAGGTGG + Intronic
1061306618 9:129736245-129736267 CTTCCCAAGCTCAAGGTGGAGGG + Intergenic
1061872142 9:133526835-133526857 CTGTCTAGGCTGCAGGCAGAGGG - Intronic
1062335259 9:136062320-136062342 CTTTCCAGGGTCCGGGTAGATGG - Intronic
1062547982 9:137072268-137072290 CTAACTAGGCTTCAGGGGGAAGG - Intergenic
1202788025 9_KI270719v1_random:50874-50896 CATTTTAGCCTCCAGGTGGTGGG + Intergenic
1186201397 X:7158573-7158595 CCTGCTACTCTCCAGGTGGAGGG + Intergenic
1191155762 X:57271044-57271066 TTTCCTGGGCTCCATGTGGATGG - Intergenic
1191606239 X:63065857-63065879 CTTACTGGGCTCCATGTGGGTGG - Intergenic
1192009246 X:67250428-67250450 CTTCCTGGGCTCCTTGTGGATGG - Intergenic
1192180844 X:68914659-68914681 GTTCCTGGGCTCCAGGTGGTGGG + Intergenic
1194098570 X:89674330-89674352 CTTTCTGGGCTCTAGGGGGTGGG - Intergenic
1194203125 X:90978994-90979016 CTTTCTGGGCTCCATGGGGGTGG + Intergenic
1195178062 X:102329644-102329666 CTTTCCAGGCTCCAGGTTCACGG + Intergenic
1195180802 X:102357449-102357471 CTTTCCAGGCTCCAGGTTCACGG - Intergenic
1195820886 X:108944306-108944328 CTTGCTGGGCTCCATGGGGATGG + Intergenic
1197051178 X:122061247-122061269 CTTGCTGGGCTCCATGGGGATGG - Intergenic
1197800112 X:130339596-130339618 CCTTCTACGCGCCAGGTGGGTGG + Intergenic
1197906236 X:131428478-131428500 CTTGCTAGGCTCCATAGGGATGG - Intergenic
1198235810 X:134734899-134734921 TTTTCGAGGCTCCATTTGGAAGG - Intronic
1199236844 X:145502588-145502610 TTTACTAGGCTCCTGGTGGGTGG + Intergenic
1200226727 X:154421556-154421578 CACTCTAGGCTCCACGTGGCTGG - Exonic
1200451592 Y:3335705-3335727 CTTTCTGGGCTCTAGGGGGTGGG - Intergenic
1200548957 Y:4554420-4554442 CTTTCTGGGCTCCATGGGGGTGG + Intergenic
1201277877 Y:12315364-12315386 TTTTCAAGGTTCCAGGTGTATGG + Intergenic
1201357767 Y:13114673-13114695 TTTTCAAGGTTCCAGGTGTATGG + Intergenic
1202330613 Y:23748790-23748812 CTTGCTGGGCTCCATGAGGAAGG - Intergenic
1202540156 Y:25921271-25921293 CTTGCTGGGCTCCATGAGGAAGG + Intergenic