ID: 921665986

View in Genome Browser
Species Human (GRCh38)
Location 1:217871516-217871538
Sequence CTGGGAAGGAGCAGTATTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921665981_921665986 0 Left 921665981 1:217871493-217871515 CCTATTTGAGGTAATGATGATGC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 921665986 1:217871516-217871538 CTGGGAAGGAGCAGTATTGCTGG 0: 1
1: 0
2: 1
3: 22
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921665986 Original CRISPR CTGGGAAGGAGCAGTATTGC TGG Exonic
900645068 1:3705329-3705351 CTGGGAAGGACCTGTGGTGCAGG + Intronic
903296194 1:22344564-22344586 CTGGACAGGAGCAGTTTTGGGGG + Intergenic
906202489 1:43968973-43968995 CTGGGAAGCAGCAGTGTTTGAGG + Intergenic
906283678 1:44571300-44571322 CTGCGAAGGAGGAGTGTTTCAGG - Intronic
908049711 1:60215812-60215834 CTGGGAAGGAGCCACATTTCTGG - Intergenic
908608434 1:65826725-65826747 CTGGGAAGGGGCAGGAATGTAGG + Intronic
909494072 1:76258540-76258562 CTGGGATGAAGCAATATTGGAGG + Intronic
911155253 1:94629886-94629908 CTGGGAAGGAGCAGTATTAGAGG - Intergenic
912385267 1:109268307-109268329 CTGGGAGGAAGCAGTATCTCAGG + Intronic
912449223 1:109759118-109759140 CTGGGAAGCAGCAGTCAGGCAGG + Intronic
914339612 1:146748880-146748902 CTGGGCAGGAGTGGTATTTCTGG + Intergenic
915316429 1:155031424-155031446 CTTGGTAGGACCAGTATTGGGGG - Intronic
915812019 1:158923194-158923216 CTGGGAAGCAGCAGTTATTCTGG - Intergenic
916533945 1:165685639-165685661 CGAGGAAGGACCAGTAGTGCAGG + Intronic
916534317 1:165689079-165689101 CTGTGAATGAGCAGCATTGTAGG - Intronic
917722261 1:177796929-177796951 CTGGGAAGGCTCAGTATTCTGGG + Intergenic
918471461 1:184880119-184880141 CTGGAAAGGAGGTGTAATGCTGG - Intronic
919847998 1:201653757-201653779 CTGGGCAGCAGCAGTAGTGATGG + Intronic
921571167 1:216780343-216780365 CAGGGAAAGAGAAGAATTGCTGG - Intronic
921665986 1:217871516-217871538 CTGGGAAGGAGCAGTATTGCTGG + Exonic
922997991 1:229982172-229982194 CTGGGAAGGAGCATGATTTTGGG + Intergenic
924815237 1:247435759-247435781 CTGGGAAGATGTAGTATTGGTGG + Intronic
924941037 1:248812588-248812610 CAGGTCAGGAGCAGGATTGCTGG - Intronic
1063531829 10:6840526-6840548 GTGGGAAGGAGCAGGGCTGCAGG - Intergenic
1064112701 10:12552392-12552414 CTGGGTGTGAGCGGTATTGCAGG - Intronic
1065330009 10:24586071-24586093 CTGGAAAGGATCAGTATAGCAGG - Exonic
1065697755 10:28395539-28395561 CAGGGAAGGAGAAGTAGTGGAGG - Intergenic
1066072338 10:31831388-31831410 CTGGGGAGGGGAAGTAATGCCGG + Intronic
1067531951 10:47080580-47080602 CTGGGAAGGATCCGAAATGCTGG + Intergenic
1067575651 10:47406683-47406705 CTTGGAATGAGCAGTGCTGCGGG + Intergenic
1071382666 10:85083793-85083815 CTGGTGAGGAGCACTAATGCTGG + Intergenic
1072591360 10:96831825-96831847 CTGGGGAGGAGCAGTTTCGACGG + Intergenic
1073867261 10:107819191-107819213 CAGGAAAGGAGCAGGATTTCAGG + Intergenic
1074835273 10:117286236-117286258 CAGGGAAGGGACAGTATGGCTGG - Intronic
1075289105 10:121213267-121213289 CTGGGTAGAAGCAGCAGTGCTGG + Intergenic
1076175385 10:128364095-128364117 CTTGGAAGGTGCTGTACTGCTGG + Intergenic
1077377972 11:2214536-2214558 CTGGGGAGGAGCAGCAGAGCGGG - Intergenic
1079857616 11:25625933-25625955 CTGGCAAGGAGAAGTATGGCTGG - Intergenic
1079907201 11:26263478-26263500 CTGGGAAGGAGCAGCTTTCTTGG - Intergenic
1079988850 11:27226121-27226143 CGGGGAAGGGGCATCATTGCAGG - Intergenic
1081534096 11:43984922-43984944 CTGGGCAGGGGCAGTATGCCAGG + Intergenic
1081741468 11:45443993-45444015 CTGGGAAGGAGCAGGATACATGG - Intergenic
1084684712 11:70686832-70686854 CTGGGAAGCAGCAGGTTTTCGGG - Intronic
1085448002 11:76614300-76614322 AGGGGAAGGAGCAGTTTTCCAGG + Intergenic
1086390859 11:86361269-86361291 CTGGGAATGGACAGTATTTCAGG + Intergenic
1087199443 11:95330704-95330726 CTGGCCAGGAGCAGTTCTGCAGG - Intergenic
1088432055 11:109769291-109769313 CTGGAAAGGAGCAGCACTGAGGG - Intergenic
1088707817 11:112479601-112479623 CTCGGGAGGAGTAGAATTGCTGG + Intergenic
1092460515 12:8681945-8681967 CTGGGTGGGAGCAGTCTTGTGGG + Intronic
1096478742 12:51924176-51924198 CTGGGAAGGCGCTGTGTTGTTGG - Intergenic
1096560740 12:52434144-52434166 CTGGGAAGGATCAGCAGTGCTGG - Exonic
1098148615 12:67523228-67523250 CTCTGAAGGAACAGCATTGCAGG - Intergenic
1098221849 12:68278540-68278562 CAGGGAAGGAGCCGCATTGGAGG - Intronic
1101239724 12:102825636-102825658 TGGGGATGGAGCAGTATTCCTGG + Intergenic
1104893915 12:132152740-132152762 CTGGGAGGGAGCAGGGTTGGGGG + Intergenic
1104942708 12:132402391-132402413 CTGGGAGGGAGCAGTTGTCCAGG - Intergenic
1106344823 13:28865742-28865764 CAGAGAAGGAGCAGTATTATTGG + Intronic
1108023897 13:46158486-46158508 CTGGGTTGGAGCAGGATTTCAGG - Intronic
1108604854 13:52027112-52027134 CTGGGCAAGAGCAGTCTTGAGGG + Intronic
1110805475 13:79749397-79749419 CTCGGAAGGAGGAGTAGGGCTGG + Intergenic
1111373762 13:87352253-87352275 CTGCCAAGGAGCAGTGTTGTGGG + Intergenic
1112748286 13:102552718-102552740 CTGGGAAGCACCAGGATAGCTGG - Intergenic
1113589901 13:111491153-111491175 CTGGGAAGGAGCTGGAATGTGGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114802601 14:25794780-25794802 CTGGAAAGGAGAAGTATAGGAGG - Intergenic
1115637166 14:35301095-35301117 CTGGGAAATACCAGTATTTCAGG + Intronic
1115950765 14:38718756-38718778 CTTGGCAGGAGCAGTTTTGATGG - Intergenic
1116779097 14:49216117-49216139 AGGGGAAGGAGAAGTATTGTAGG - Intergenic
1117712065 14:58541078-58541100 CTGGGAAGCAACTGCATTGCTGG + Intronic
1118570411 14:67189306-67189328 CTGGGGAGGAGCAGCCGTGCAGG - Intergenic
1118846939 14:69554582-69554604 CTGGGATGGAGCAGTCCTGGTGG + Intergenic
1118860799 14:69661470-69661492 CAGGGAAGGAGCATTCTTTCAGG - Intronic
1119438960 14:74615584-74615606 CTGTGAAGGAGCAGCATCCCAGG - Intergenic
1121749271 14:96334964-96334986 CTGGGAAGGCACAGTGTTGGAGG - Intronic
1125172284 15:36779257-36779279 CTGTGAAGGAGGAGTAAGGCTGG - Intronic
1125583176 15:40801942-40801964 CTGGGCTGGAGCAGTAGTGGTGG + Intronic
1128168727 15:65491445-65491467 CTGGGAAGGAGCATGAGTACTGG - Intronic
1128657383 15:69472322-69472344 CTGGGAAGGAGCAGACTGTCAGG - Intergenic
1139994674 16:70968528-70968550 CTGGGCAGGAGTGGTATTTCTGG - Intronic
1140442139 16:74996328-74996350 CTAGGTAGGAGCAGAATTGCTGG + Intronic
1142025465 16:87810570-87810592 CTGGGACGGAGCAGCATAGAGGG + Intergenic
1142052047 16:87965250-87965272 CTGGGCTGGAGCAGTTTTGGGGG + Intronic
1144085798 17:11807467-11807489 ATGGAAGGGAGCAGGATTGCAGG - Intronic
1145846000 17:28039945-28039967 CTGGGAAGTAGCAGAAGTGAGGG + Intergenic
1146405538 17:32533657-32533679 CTGGGAAGGAGCAGGAGGCCTGG - Intronic
1147254506 17:39174091-39174113 CTGGGGAGGGGCAGGGTTGCTGG + Exonic
1147891656 17:43721548-43721570 CTGGGGAGGAGATGTATTTCAGG + Intergenic
1149756915 17:59194468-59194490 CGGGGAAGATGCAATATTGCAGG + Intronic
1151538053 17:74749624-74749646 CAGGGAAGGAGCAGGATTGGGGG - Intronic
1151837608 17:76593537-76593559 GTGGGAGGGAGCAGTCTTGTGGG + Intergenic
1154154945 18:11936662-11936684 CTGGGGAGGAGCAGGAATGCCGG + Intergenic
1155061281 18:22231104-22231126 CTGGTAAGCAGGAGAATTGCTGG + Intergenic
1155400787 18:25436874-25436896 GAGGGAAGGAGCAGTATTCTAGG + Intergenic
1155422842 18:25674097-25674119 ATGGCTAGGAGCAGAATTGCTGG + Intergenic
1157750918 18:50177596-50177618 GTGGGAGGGAGCAGTTTTCCAGG + Intronic
1159182898 18:64932640-64932662 TTTGGAAGGAACAGTATTTCAGG - Intergenic
1160080083 18:75718044-75718066 CTGGGTAGGAGCAAGTTTGCTGG - Intergenic
1163585207 19:18160275-18160297 CTGGGAAAGGGCAGAATTGATGG - Intronic
1164778371 19:30872439-30872461 CTGAGAAGGAGAATTGTTGCAGG - Intergenic
1165422369 19:35728565-35728587 CTGGGGAGGAAGAGTATTGCAGG + Intronic
1166455821 19:42938698-42938720 CAGGGAAGGAGCAGGTGTGCGGG + Intronic
1166502086 19:43349198-43349220 CTGGGAAGGAGAAGTAAAGCTGG - Intergenic
1166508026 19:43384254-43384276 CTGGGAAGGAGAAGTAAAGCTGG + Intergenic
1166519595 19:43471524-43471546 CTGGGAGTGATCTGTATTGCTGG - Intergenic
925886869 2:8401118-8401140 GGGGGAAGGAGAAGCATTGCTGG + Intergenic
928550277 2:32363555-32363577 CTGGGGAGGGGCATTATTTCAGG - Intronic
928699933 2:33888315-33888337 CTGGAAATGAACATTATTGCTGG + Intergenic
930152019 2:48068896-48068918 CTGAGAAGGAGCAGTGAGGCAGG + Intergenic
930567219 2:53036143-53036165 CTGGAAGGCAGCAGTATAGCTGG - Intergenic
932764400 2:74460791-74460813 CTGGAGAGGGGCAGTATTGGGGG + Exonic
942330231 2:174816013-174816035 GTGGGAGGGAGAGGTATTGCAGG + Intronic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
945855479 2:215064372-215064394 CTGAGTAGGAGCAGTCTTGGAGG + Intronic
947772738 2:232683631-232683653 ATAGGAAGGAGCAGGATTGCTGG - Intergenic
947795261 2:232890365-232890387 CTGGGAAGGAGCAGCGGTGAGGG - Intronic
947840255 2:233203229-233203251 CTGGGTCGGAGCAGAATTGCTGG + Intronic
948995461 2:241576102-241576124 AAGGGGAGGAGGAGTATTGCAGG - Intergenic
1170285422 20:14703305-14703327 CTGGGAAGGAGGGGTATGTCAGG + Intronic
1171558930 20:26104045-26104067 CTGGGAAAGAGTATTATTCCAGG + Intergenic
1172146125 20:32759769-32759791 TTGGGAAGGAGCAGGAATGTTGG - Intergenic
1173316827 20:41952073-41952095 CAGGGACTGAGCAGCATTGCTGG - Intergenic
1174154701 20:48508849-48508871 CTGGGGAGGAGAAGTCTTGTTGG - Intergenic
1174244931 20:49171672-49171694 CTGGGAGGGAGAAGTAATGGTGG - Intronic
1174435557 20:50504115-50504137 CTGGGAATGATCTGTATTGCAGG + Intergenic
1177055144 21:16292503-16292525 TTGGAAAGGAGCAGGATTTCAGG - Intergenic
1178518669 21:33268884-33268906 CTAGGTATGAGTAGTATTGCTGG + Intronic
1181591602 22:23889006-23889028 CTGGGAGGCAGCAGCGTTGCAGG + Intronic
950213338 3:11140041-11140063 CTGGGCAGGTGCAGCCTTGCAGG + Intronic
950726623 3:14921239-14921261 CTGGGCGGGAGCAGTGCTGCAGG - Intronic
951984075 3:28598450-28598472 CTGGAAAGGAGCAGGATTTGGGG + Intergenic
952532694 3:34278646-34278668 CTGGGAAGCAGTAGAATTACAGG + Intergenic
954794299 3:53153775-53153797 CTGTGAAGGAAAAGAATTGCTGG + Intergenic
954820332 3:53321023-53321045 CTGGGCTGGCCCAGTATTGCTGG + Intronic
955977047 3:64489528-64489550 CCGGCAAGGAGCAGGAGTGCAGG + Intergenic
961429732 3:126872809-126872831 CAGGGAAGGAGCAGCAGGGCAGG - Intronic
961447500 3:126987754-126987776 CTGGGAAGGGGCCGTGTGGCGGG + Intergenic
971571248 4:28213665-28213687 CTGAGAAGGAGCAATTTTGCAGG + Intergenic
971657810 4:29372146-29372168 GTGGGAAGTACCAGTATTCCTGG + Intergenic
976612677 4:87046045-87046067 CTGGGAAGAAGCAGTGATGACGG - Intronic
978619422 4:110623333-110623355 CTGGGCAGGAGCTGAATTCCCGG - Intronic
981008636 4:139901775-139901797 GCGGGAAGGAGCAATATTTCAGG + Intronic
983608073 4:169612665-169612687 CTGGGAAGGAGCAGTGAGGCTGG + Intronic
984585047 4:181553892-181553914 GGGGGATGGAGCAGGATTGCTGG - Intergenic
985249995 4:188014125-188014147 CTGGCAAGGGGCAGTTTTGCAGG + Intergenic
985772771 5:1823589-1823611 CAGGGAATGAGCAGTATAACAGG - Intergenic
988213133 5:28234543-28234565 CTGAGAAGTAGGAGTATTTCTGG + Intergenic
992079217 5:73218214-73218236 GTGGGAAAGAGCTGTACTGCTGG + Intergenic
992493659 5:77270771-77270793 CTGGGAAGAAGCAGCAGGGCTGG + Intronic
996026764 5:118655075-118655097 ATAGCAAGGAGCACTATTGCTGG + Intergenic
996282008 5:121741386-121741408 CTGAGAAGGAGCAATGTTGGTGG + Intergenic
996496147 5:124158938-124158960 CAGGGAAGTAGCAGTATTTGAGG - Intergenic
997256796 5:132435212-132435234 CTGGGAAGGAGTGGCATTCCAGG - Intronic
998062976 5:139133559-139133581 GGGAGAGGGAGCAGTATTGCTGG + Intronic
1001198976 5:169698833-169698855 CTGTGAAGCAGCAGCATTTCAGG + Intronic
1004877011 6:19966308-19966330 CTGGGAAGGAGCAGCAATCACGG + Intergenic
1005863705 6:29922336-29922358 CTGGAAGGGAGCAGTATTAAAGG - Intergenic
1006746716 6:36347777-36347799 CAGGGAAGGAGCCGTATTTCAGG + Intergenic
1008477387 6:51947111-51947133 CTTGAGAGGAGCAGTTTTGCAGG - Intronic
1010571145 6:77475626-77475648 CAGGGAAGGAGCAGCCCTGCCGG + Intergenic
1010791080 6:80065942-80065964 CTGGAAAGGATCAGTATAGCAGG - Intergenic
1012547142 6:100432900-100432922 GTGGGAAGGAACAGTTTAGCAGG - Intronic
1014544981 6:122724055-122724077 CTTGGTAGGAGCAGTTTTGCAGG + Intronic
1015820659 6:137257199-137257221 CAGGGCAGGAACATTATTGCTGG - Intergenic
1016364174 6:143297633-143297655 CTGAGTAGGAGCAGTGTTACAGG - Intronic
1018402618 6:163440234-163440256 TGGGGATGGAGCAGTAGTGCTGG + Intronic
1018473289 6:164115060-164115082 CTGGGGACGAGAAGTATTTCAGG + Intergenic
1021117452 7:16759981-16760003 CTGGCCAGGAGGAGTATTGCTGG + Intronic
1023458764 7:40370290-40370312 CAGGGAAGGATCAGTTTTGAGGG + Intronic
1024026402 7:45413550-45413572 CTGGGAAGGGGCAGTGGTCCTGG - Intergenic
1024220958 7:47286242-47286264 CTGATGAGGAGCAGTCTTGCTGG + Intronic
1025194342 7:56921010-56921032 CAGGGTAGGAGCTGTATTTCTGG - Intergenic
1025243269 7:57295808-57295830 CTGGGTAGAAGCAGGATTGCTGG + Intergenic
1025677610 7:63655943-63655965 CAGGGTAGGAGCTGTATTTCTGG + Intergenic
1029227158 7:99036513-99036535 CTTGGATGGAGCAGTAGTTCTGG - Intronic
1030161421 7:106512320-106512342 CTGGGAAAGATCAGACTTGCAGG - Intergenic
1031070180 7:117153373-117153395 CTGGGAAGGATCAGCATGGGAGG + Intronic
1032719101 7:134536456-134536478 CTGGGGAGGGGCAGTAGGGCTGG + Intronic
1032724075 7:134575226-134575248 CTGGGGAGGGGCAGTAGGGCTGG + Intronic
1033601832 7:142894094-142894116 CAGGGAAGGAGCAGAACTGAGGG + Intergenic
1035269621 7:157711729-157711751 CTGGGACGCAGCAGTTCTGCCGG + Intronic
1035295314 7:157864146-157864168 CTTGGAAGGAGCAGCGATGCCGG - Intronic
1035597481 8:870368-870390 CTGGGAGGGAACAGGAATGCCGG - Intergenic
1035774395 8:2176759-2176781 CTGGAAAGTGTCAGTATTGCTGG - Intergenic
1037762137 8:21748576-21748598 CTGGAAAGAAGCAGTTTAGCTGG + Intronic
1039735087 8:40323323-40323345 CTGGGAAGGGACAGTATTGAGGG - Intergenic
1039886389 8:41656464-41656486 CTGGAAAAGAGCAGCTTTGCTGG + Intronic
1041724762 8:61007829-61007851 GAGGGAAGGAGCAGTGTGGCAGG + Intergenic
1042219019 8:66455142-66455164 ATAGGTAGGAGCAGAATTGCTGG + Intronic
1042406415 8:68410532-68410554 TTGGGAAGGGGCAGGAGTGCTGG + Intronic
1043282706 8:78488218-78488240 GTGGGACGGAGCAGGATGGCAGG + Intergenic
1044032948 8:87261037-87261059 GTAGGAAGCAGTAGTATTGCAGG - Intronic
1045841449 8:106586715-106586737 CTGAGAAGGAGCAGCAGTGGAGG + Intronic
1048250724 8:132864725-132864747 CTGGTGAGGAGCAGTACAGCAGG + Intergenic
1049159429 8:141087768-141087790 GGGGGAAGGAACCGTATTGCTGG - Intergenic
1049873903 8:145002992-145003014 CCGGGAAGGAGCAGGACTGCCGG - Intergenic
1050013998 9:1213616-1213638 GTGGGAAGTAGTAGTCTTGCTGG + Intergenic
1050072428 9:1829871-1829893 CTGGGCAGTAGCTGTACTGCAGG - Intergenic
1052199437 9:25760602-25760624 CTGGGCTGGAGCAGAGTTGCAGG + Intergenic
1052421636 9:28250515-28250537 CAGGAAAGGGGCAGTTTTGCAGG + Intronic
1056104742 9:83336034-83336056 CTGGGAGAGAGCAGTTTTGATGG - Intronic
1056825763 9:89875303-89875325 CTAAGAAGAAGCAGCATTGCAGG - Intergenic
1059928074 9:119232070-119232092 CTGGTAAGGACCAGTTTTGATGG - Intronic
1061571005 9:131477416-131477438 CTGGAGAGGAGCAGAAATGCTGG + Intronic
1062319031 9:135981504-135981526 CTGGGAAGGAGCAGGCTCGGGGG - Intergenic
1203346407 Un_KI270442v1:37781-37803 ATGGGAAGGAATAGTATTGAAGG + Intergenic
1186083235 X:5956475-5956497 CTGAGAAAAATCAGTATTGCTGG + Intronic
1186084763 X:5975053-5975075 TTGGGAGGGAGCAGGACTGCTGG + Intronic
1187119477 X:16390340-16390362 CTAAAAAGGAGCAGAATTGCTGG - Intergenic
1187509647 X:19906143-19906165 GTGGGAAGGAATAGTATTGAAGG + Intergenic
1189001709 X:36954929-36954951 CTGGGAAATAGCAGAACTGCGGG - Intergenic
1189151086 X:38707438-38707460 GTGGGAAGGGGCACTATTCCTGG - Intergenic
1189350518 X:40272304-40272326 CTGGGTAGGAGCAGGTCTGCCGG - Intergenic
1191168872 X:57421028-57421050 CTGGGAAGGGGAAATAATGCAGG - Intronic
1193876551 X:86869005-86869027 TTGGGCAGGAGGAGTACTGCCGG + Intergenic
1194383952 X:93230098-93230120 TTTGGAAGGAAAAGTATTGCAGG + Intergenic
1195704688 X:107730358-107730380 GTGGGAAGGAACACTAGTGCAGG - Intronic
1196893526 X:120311519-120311541 CTGGGAGGCAGCAGCATTGGCGG + Intronic
1198822657 X:140665551-140665573 ATGGGAAGGAGGAGTAGGGCTGG + Intergenic
1199661079 X:150051789-150051811 CTGAGAAGCAGCAGTCTTGGAGG - Intergenic
1201511067 Y:14763771-14763793 TTGGGAGGGAGCAGGACTGCTGG - Intronic