ID: 921668063

View in Genome Browser
Species Human (GRCh38)
Location 1:217896151-217896173
Sequence CTGCATCCTTTCAATAATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921668057_921668063 10 Left 921668057 1:217896118-217896140 CCTCGAGCAGTGAAAAGGTGGCA No data
Right 921668063 1:217896151-217896173 CTGCATCCTTTCAATAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921668063 Original CRISPR CTGCATCCTTTCAATAATGT GGG Intergenic
No off target data available for this crispr