ID: 921669407

View in Genome Browser
Species Human (GRCh38)
Location 1:217909518-217909540
Sequence CAAAATAAGTATTTGGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921669407_921669410 -2 Left 921669407 1:217909518-217909540 CCTGATTCCAAATACTTATTTTG No data
Right 921669410 1:217909539-217909561 TGGTTCCTAAAATTATATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921669407 Original CRISPR CAAAATAAGTATTTGGAATC AGG (reversed) Intergenic
No off target data available for this crispr