ID: 921670207

View in Genome Browser
Species Human (GRCh38)
Location 1:217916582-217916604
Sequence CATTCTAAGTAGAAGAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921670201_921670207 22 Left 921670201 1:217916537-217916559 CCAGATATGTATGGGTTTTCAAA No data
Right 921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921670207 Original CRISPR CATTCTAAGTAGAAGAGGGA TGG Intergenic
No off target data available for this crispr