ID: 921670584

View in Genome Browser
Species Human (GRCh38)
Location 1:217919870-217919892
Sequence GCTGCCTGTGCTACACATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921670579_921670584 6 Left 921670579 1:217919841-217919863 CCAGCATGCAGTGTCGTTTCCCT 0: 1
1: 0
2: 0
3: 5
4: 87
Right 921670584 1:217919870-217919892 GCTGCCTGTGCTACACATTCTGG 0: 1
1: 0
2: 2
3: 8
4: 120
921670578_921670584 7 Left 921670578 1:217919840-217919862 CCCAGCATGCAGTGTCGTTTCCC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 921670584 1:217919870-217919892 GCTGCCTGTGCTACACATTCTGG 0: 1
1: 0
2: 2
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921670584 Original CRISPR GCTGCCTGTGCTACACATTC TGG Intergenic
903018226 1:20375627-20375649 GAAGCCTGTGCTACATTTTCTGG + Intergenic
903825245 1:26140138-26140160 GCTCCCTGTGTTTCACATCCTGG - Intergenic
904868846 1:33603679-33603701 CCAGCCTGTGCTACAGATGCTGG - Intronic
908119306 1:60970790-60970812 GCTGACTGTGATACACATCCAGG - Intronic
908670837 1:66545750-66545772 CCAGCCTGTGCTACAAATTTTGG - Intronic
912110975 1:106342326-106342348 GCTACCTGTGCTACAAATAAAGG + Intergenic
913570105 1:120111182-120111204 GCTGCCTGTGGTACATAGCCTGG + Intergenic
914290914 1:146272148-146272170 GCTGCCTGTGGTACATAGCCTGG + Intergenic
914551958 1:148722931-148722953 GCTGCCTGTGGTACATAGCCTGG + Intergenic
917382064 1:174422334-174422356 GCTGCCTGTGCTAGATAATAAGG + Intronic
917856544 1:179105589-179105611 GCTGCCTGTGCTGCAACTGCAGG + Exonic
921670584 1:217919870-217919892 GCTGCCTGTGCTACACATTCTGG + Intergenic
922528645 1:226326014-226326036 ACTGCCTGTGCTACACGTTCAGG - Intergenic
922552413 1:226505690-226505712 GCTTCTTATGCAACACATTCTGG + Intergenic
924888475 1:248246561-248246583 GCTCCCTTTTCTCCACATTCTGG + Intergenic
1067060448 10:43075607-43075629 GCTACCTAGGCTACACACTCAGG - Intergenic
1068903602 10:62298111-62298133 GCTGACTGTTCTCCACATTGTGG + Intergenic
1071489626 10:86127525-86127547 GCTGCCTGGGCTCCAGATGCTGG - Intronic
1077409340 11:2396156-2396178 GCGCCCTGTGCTGCGCATTCCGG + Intronic
1081465805 11:43315732-43315754 TCTGCCTCTGCTACTCCTTCAGG + Intronic
1081514699 11:43815587-43815609 GCTGCCTGTGGTTCACACGCTGG + Intronic
1081934075 11:46892894-46892916 GCTACCTGGACTAGACATTCTGG - Intronic
1086699358 11:89882512-89882534 GCTGCCTGAACTACACAATCTGG - Intergenic
1086706813 11:89962002-89962024 GCTGCCTGAACTACACAATCTGG + Intergenic
1090463905 11:126916121-126916143 CCTACCTTTGCTACTCATTCAGG - Intronic
1092686365 12:11051759-11051781 GCTTCCTGTGCTCAACATTATGG + Intronic
1100466192 12:94848045-94848067 TCTGCCTTTGCTTCACATTGAGG + Intergenic
1102018678 12:109666218-109666240 TCTTCCTGTGTTATACATTCTGG - Intergenic
1105463017 13:20609195-20609217 GATGCCTGTGTGACACATTTGGG + Intronic
1107668643 13:42719223-42719245 GGTGCCTGTGGGACACATGCAGG + Intergenic
1111275657 13:85943029-85943051 CATGCCTGTGCAACCCATTCAGG - Intergenic
1111600017 13:90460954-90460976 GCAGCCTGTGCCACACTGTCAGG - Intergenic
1112853873 13:103741444-103741466 GCTGCTTGTGCCAGCCATTCAGG - Intergenic
1113134117 13:107070532-107070554 GCTGCCTGAGCAACACAGTCAGG + Intergenic
1117972339 14:61264671-61264693 TCTGCCTGTGTTGCTCATTCAGG - Intronic
1122921329 14:104881577-104881599 GCTGCATGTGTTTCACAGTCTGG - Intronic
1123875730 15:24622039-24622061 GCAGCCTGTGCTAGACTGTCAGG - Intergenic
1124954299 15:34349916-34349938 TCTGCTTGTGCTTCACACTCAGG + Intronic
1131965491 15:97837877-97837899 GCTGCAAGTGCCACACAGTCTGG + Intergenic
1132045124 15:98557339-98557361 GCTTCCTGTGGTAGACATTCTGG + Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1136272595 16:29157547-29157569 GCAGCCTGTGGTGCACCTTCGGG + Intergenic
1141113650 16:81290388-81290410 GCTGCCTTTTCTGCTCATTCTGG + Exonic
1141876007 16:86825021-86825043 CCTGCCTGTGGCACACATCCCGG + Intergenic
1142771519 17:2100845-2100867 CCAGCCTGTGCAATACATTCTGG - Intronic
1145842416 17:28007044-28007066 GCTGCCTGTGCTCCCTATTGGGG + Intergenic
1146121284 17:30197596-30197618 TCTCTCTGTGCTAAACATTCAGG - Exonic
1157114814 18:44852718-44852740 GGTGCCTTTGATACCCATTCTGG + Intronic
1159562795 18:70013171-70013193 GCTGCAAGTGCTACTCATTAGGG + Intronic
1161284956 19:3464090-3464112 GCTGCCAGTGCCTTACATTCTGG + Intronic
1162344264 19:10110573-10110595 CCTGCTTGCGCTGCACATTCTGG - Exonic
1164180652 19:22815447-22815469 GCTGCCTGTGCTCTGCTTTCAGG + Intergenic
1165447007 19:35861909-35861931 GATCTCTGTGCTACACATTTCGG + Exonic
925796850 2:7554864-7554886 GCTGCCTGTGCTTCAGCTGCTGG - Intergenic
931638265 2:64359957-64359979 GCTGCCAGTGAGACACACTCAGG - Intergenic
937691581 2:124761908-124761930 ACTGCCTTTCATACACATTCTGG - Intronic
945862898 2:215144178-215144200 GCTCCCTGTGCTACACAAAATGG - Intergenic
946530905 2:220569453-220569475 GCTGCCACAGTTACACATTCTGG - Intergenic
1168851573 20:980611-980633 GCAGCCTCTGCTGGACATTCTGG + Intronic
1168941106 20:1712080-1712102 GCTGCCTGTGCTGCACAGAAGGG - Intergenic
1169220687 20:3820647-3820669 GCTGCAGGGGCAACACATTCAGG + Exonic
1171147913 20:22801887-22801909 GCTGCCTGTGATTCATAATCAGG + Intergenic
1171366704 20:24629820-24629842 GCTGCCTGGGCTCCTCACTCTGG - Intronic
1171462784 20:25308342-25308364 GCAGCATGAGCTGCACATTCTGG - Intronic
1172633608 20:36394671-36394693 GCTGCCTCTGCCACCCTTTCCGG + Intronic
1183342045 22:37286863-37286885 CCTGCCTCTTCTACCCATTCTGG - Intronic
1184859340 22:47164391-47164413 CCTGCCTGTCCTTCACACTCAGG - Intronic
952530883 3:34260582-34260604 CCTCCCTGTGCTACAAATTGTGG - Intergenic
953593795 3:44287919-44287941 GCTGCCTTTTATTCACATTCTGG + Intronic
953851080 3:46465879-46465901 GGTGCCTGTGGGACACATTGGGG + Intronic
959476702 3:106821140-106821162 GCTGCCTGAGGTACACACACTGG - Intergenic
968964076 4:3760670-3760692 GCTGCCTGAGCCTGACATTCAGG - Intergenic
969862561 4:10049051-10049073 GCTGTCTGGACTAGACATTCTGG - Intronic
969922341 4:10552240-10552262 GCTACCTTTGGAACACATTCAGG + Intronic
971608609 4:28691597-28691619 ACTGCCTGTCTTACACATTTTGG + Intergenic
974566295 4:63581285-63581307 GCTGCCTGTGTGACTCAGTCTGG + Intergenic
978321041 4:107496232-107496254 GCTGACTGTGCTTCACTGTCTGG + Intergenic
981568024 4:146121544-146121566 GCTGGCTGTGCTCCTGATTCCGG + Intergenic
982423513 4:155227264-155227286 GCTGGCTTTGCTTCACGTTCTGG - Intergenic
986005263 5:3662151-3662173 CCTGCCTGTCCTACAAATTTGGG + Intergenic
987475422 5:18386031-18386053 CTGGCCTGTGCTACACATTTCGG + Intergenic
988652413 5:33167017-33167039 GCTGCCTCTGCTGCATATACAGG + Intergenic
988851626 5:35186675-35186697 GCTGCCTCTGCTCCACAATGAGG - Intronic
997337685 5:133119438-133119460 GCTGTCTGAGCTACACAGCCAGG - Intergenic
997649858 5:135508449-135508471 GCTGGCTGTGCTCTTCATTCAGG + Intergenic
1002261752 5:177998028-177998050 GCTGCCTGGGGTACCCATTCTGG + Intergenic
1004043837 6:12008711-12008733 GCTGCCTGTGCCCCCCTTTCTGG - Intergenic
1005219203 6:23566655-23566677 GCAGCATCTGCTACACATTCTGG - Intergenic
1005834124 6:29695095-29695117 GCTGCCTGTGCTCACCATTGTGG - Intergenic
1007954114 6:45901048-45901070 CCTGCCTGTGCTGTAAATTCGGG + Exonic
1014271997 6:119346957-119346979 CCTGCCTGTGCTACCAAATCAGG - Intronic
1016352092 6:143178808-143178830 GCTGCCTGTGCTATAAATGGGGG + Intronic
1018872207 6:167791751-167791773 GCTTCCTGTGCTGCCCACTCTGG + Intronic
1022208309 7:28183761-28183783 GCTGTCTGTCCTCCACATACAGG + Intergenic
1024393347 7:48839716-48839738 GCAGCCTGTGGTAGACATTGTGG - Intergenic
1024822573 7:53350391-53350413 GCTGCCTGTGATCAACCTTCTGG + Intergenic
1026408194 7:70090578-70090600 GCTAGCTGTGCTACAATTTCTGG + Intronic
1027972104 7:85097640-85097662 ATTGCCTCTGATACACATTCTGG - Intronic
1028218768 7:88168855-88168877 GCAGCTTGTGCTAGGCATTCTGG + Intronic
1029558926 7:101289719-101289741 GCTGTCTCTGCTGCACCTTCTGG - Intergenic
1032812453 7:135434368-135434390 GCTGCCTGCACTACAAAGTCTGG + Intronic
1033449187 7:141447750-141447772 GCTGCCCCTGCAACACCTTCAGG - Intronic
1034207659 7:149331646-149331668 GCTGCCTCTACCACAGATTCTGG + Intergenic
1034447291 7:151120174-151120196 GCTGCCTTTGCTGCACAGGCAGG + Intronic
1035216519 7:157371645-157371667 TTTGCATGTGCTCCACATTCTGG - Intronic
1036995930 8:13656706-13656728 GCTGAATGAGCTACTCATTCAGG - Intergenic
1037307258 8:17518450-17518472 GCTGCCTGTGCTTCACTTTCTGG + Intronic
1043075644 8:75695459-75695481 CCTGCCTGGGCTGCAGATTCTGG + Intergenic
1044298734 8:90558541-90558563 GCTTCCTATTCTACACTTTCTGG - Intergenic
1044693864 8:94903875-94903897 GCTGCCTGCCCCACACATCCTGG - Intronic
1049184545 8:141242859-141242881 GTGGCCTGGGATACACATTCAGG - Intronic
1049334870 8:142078650-142078672 TCTCCCGGTGCTACACATTGTGG + Intergenic
1051526862 9:18055011-18055033 GCTGCCTGTGCCACCCACTCCGG - Intergenic
1051839533 9:21379617-21379639 GCTGCCTGTACAACACACTTCGG - Intergenic
1052509632 9:29398979-29399001 GGTGCCTGTGGAACAAATTCTGG - Intergenic
1056221062 9:84451142-84451164 TCTGCCTCTGCTACAAAGTCAGG - Intergenic
1056758168 9:89395697-89395719 GCTGCCTGTACCACAGATGCTGG - Intronic
1060723754 9:125994490-125994512 CAGGCCTGTGCCACACATTCAGG + Intergenic
1187466556 X:19532694-19532716 GCTGCCTCTGCTCCACATGTTGG + Intergenic
1192394242 X:70762481-70762503 CCTGCCTGAGCTCCACCTTCTGG + Intronic
1197999208 X:132414445-132414467 GTTGTCTGTGGTACACACTCTGG - Intronic
1199540846 X:148956318-148956340 GCTGCCACTGCTACTCATTAAGG - Exonic
1200569343 Y:4808786-4808808 GCAGCCTGGGCAACACAGTCAGG + Intergenic
1200698672 Y:6383673-6383695 GCTGCCTGCACTCCACATTGTGG - Intergenic
1200911017 Y:8531490-8531512 GCTGGCTGTGCTCCAGATTGTGG + Intergenic
1200947566 Y:8861891-8861913 GTTGCTTCTGCTACACATTTTGG + Intergenic
1200962473 Y:9008068-9008090 GCTTACTGTGCTCCACATTTTGG + Intergenic
1201035442 Y:9781026-9781048 GCTGCCTGCACTCCACATTGTGG + Intergenic
1201038044 Y:9802707-9802729 GCTGGCTGTGCTCCAGATTGTGG + Intergenic
1201362380 Y:13167027-13167049 CATGCCTGTGCTACAACTTCAGG - Intergenic
1202128984 Y:21593291-21593313 GCTTACTGTGCTCCACATTTTGG + Intergenic