ID: 921671097

View in Genome Browser
Species Human (GRCh38)
Location 1:217925038-217925060
Sequence CGCCGGCCGCGGGCACACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921671097_921671106 -6 Left 921671097 1:217925038-217925060 CCTCCGTGTGCCCGCGGCCGGCG No data
Right 921671106 1:217925055-217925077 CCGGCGGGACCCCAGGCCCTGGG No data
921671097_921671104 -7 Left 921671097 1:217925038-217925060 CCTCCGTGTGCCCGCGGCCGGCG No data
Right 921671104 1:217925054-217925076 GCCGGCGGGACCCCAGGCCCTGG No data
921671097_921671115 13 Left 921671097 1:217925038-217925060 CCTCCGTGTGCCCGCGGCCGGCG No data
Right 921671115 1:217925074-217925096 TGGGCGCGCTCGGCCCAGGCGGG No data
921671097_921671111 9 Left 921671097 1:217925038-217925060 CCTCCGTGTGCCCGCGGCCGGCG No data
Right 921671111 1:217925070-217925092 GCCCTGGGCGCGCTCGGCCCAGG No data
921671097_921671116 16 Left 921671097 1:217925038-217925060 CCTCCGTGTGCCCGCGGCCGGCG No data
Right 921671116 1:217925077-217925099 GCGCGCTCGGCCCAGGCGGGCGG No data
921671097_921671114 12 Left 921671097 1:217925038-217925060 CCTCCGTGTGCCCGCGGCCGGCG No data
Right 921671114 1:217925073-217925095 CTGGGCGCGCTCGGCCCAGGCGG No data
921671097_921671108 3 Left 921671097 1:217925038-217925060 CCTCCGTGTGCCCGCGGCCGGCG No data
Right 921671108 1:217925064-217925086 CCCCAGGCCCTGGGCGCGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921671097 Original CRISPR CGCCGGCCGCGGGCACACGG AGG (reversed) Intergenic
No off target data available for this crispr