ID: 921676607

View in Genome Browser
Species Human (GRCh38)
Location 1:217983153-217983175
Sequence AAGGGCCTAGTGAGCTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921676603_921676607 1 Left 921676603 1:217983129-217983151 CCGAGGAACATTCCAAAGAAAAA No data
Right 921676607 1:217983153-217983175 AAGGGCCTAGTGAGCTGTTGAGG No data
921676602_921676607 13 Left 921676602 1:217983117-217983139 CCTTAATGGGCTCCGAGGAACAT No data
Right 921676607 1:217983153-217983175 AAGGGCCTAGTGAGCTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921676607 Original CRISPR AAGGGCCTAGTGAGCTGTTG AGG Intergenic
No off target data available for this crispr