ID: 921681238

View in Genome Browser
Species Human (GRCh38)
Location 1:218034640-218034662
Sequence ATCCATTATCATCACAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921681238_921681244 27 Left 921681238 1:218034640-218034662 CCTCCATTGTGATGATAATGGAT No data
Right 921681244 1:218034690-218034712 GGTCACCGTAAGCTCCTTAATGG No data
921681238_921681241 -2 Left 921681238 1:218034640-218034662 CCTCCATTGTGATGATAATGGAT No data
Right 921681241 1:218034661-218034683 ATTCCGTGTTGTTGGCGCAAAGG No data
921681238_921681240 -10 Left 921681238 1:218034640-218034662 CCTCCATTGTGATGATAATGGAT No data
Right 921681240 1:218034653-218034675 GATAATGGATTCCGTGTTGTTGG No data
921681238_921681243 6 Left 921681238 1:218034640-218034662 CCTCCATTGTGATGATAATGGAT No data
Right 921681243 1:218034669-218034691 TTGTTGGCGCAAAGGTCGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921681238 Original CRISPR ATCCATTATCATCACAATGG AGG (reversed) Intergenic
No off target data available for this crispr