ID: 921681239

View in Genome Browser
Species Human (GRCh38)
Location 1:218034643-218034665
Sequence GGAATCCATTATCATCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921681239_921681241 -5 Left 921681239 1:218034643-218034665 CCATTGTGATGATAATGGATTCC No data
Right 921681241 1:218034661-218034683 ATTCCGTGTTGTTGGCGCAAAGG No data
921681239_921681243 3 Left 921681239 1:218034643-218034665 CCATTGTGATGATAATGGATTCC No data
Right 921681243 1:218034669-218034691 TTGTTGGCGCAAAGGTCGCGAGG No data
921681239_921681244 24 Left 921681239 1:218034643-218034665 CCATTGTGATGATAATGGATTCC No data
Right 921681244 1:218034690-218034712 GGTCACCGTAAGCTCCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921681239 Original CRISPR GGAATCCATTATCATCACAA TGG (reversed) Intergenic
No off target data available for this crispr