ID: 921681242

View in Genome Browser
Species Human (GRCh38)
Location 1:218034664-218034686
Sequence CGACCTTTGCGCCAACAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921681242_921681244 3 Left 921681242 1:218034664-218034686 CCGTGTTGTTGGCGCAAAGGTCG No data
Right 921681244 1:218034690-218034712 GGTCACCGTAAGCTCCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921681242 Original CRISPR CGACCTTTGCGCCAACAACA CGG (reversed) Intergenic
No off target data available for this crispr