ID: 921681244

View in Genome Browser
Species Human (GRCh38)
Location 1:218034690-218034712
Sequence GGTCACCGTAAGCTCCTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921681239_921681244 24 Left 921681239 1:218034643-218034665 CCATTGTGATGATAATGGATTCC No data
Right 921681244 1:218034690-218034712 GGTCACCGTAAGCTCCTTAATGG No data
921681238_921681244 27 Left 921681238 1:218034640-218034662 CCTCCATTGTGATGATAATGGAT No data
Right 921681244 1:218034690-218034712 GGTCACCGTAAGCTCCTTAATGG No data
921681242_921681244 3 Left 921681242 1:218034664-218034686 CCGTGTTGTTGGCGCAAAGGTCG No data
Right 921681244 1:218034690-218034712 GGTCACCGTAAGCTCCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921681244 Original CRISPR GGTCACCGTAAGCTCCTTAA TGG Intergenic
No off target data available for this crispr