ID: 921685306

View in Genome Browser
Species Human (GRCh38)
Location 1:218082982-218083004
Sequence GGGGCTGGTGGGAGTCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921685306_921685316 5 Left 921685306 1:218082982-218083004 CCCCACTGACTCCCACCAGCCCC No data
Right 921685316 1:218083010-218083032 CTGCACCTCTCAGTCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921685306 Original CRISPR GGGGCTGGTGGGAGTCAGTG GGG (reversed) Intergenic
No off target data available for this crispr