ID: 921686790

View in Genome Browser
Species Human (GRCh38)
Location 1:218098499-218098521
Sequence CACGGTAAGCAGAAGTCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921686790_921686796 3 Left 921686790 1:218098499-218098521 CCCTCCGACTTCTGCTTACCGTG No data
Right 921686796 1:218098525-218098547 CATATAGTGTATAGGAAACAGGG No data
921686790_921686795 2 Left 921686790 1:218098499-218098521 CCCTCCGACTTCTGCTTACCGTG No data
Right 921686795 1:218098524-218098546 ACATATAGTGTATAGGAAACAGG No data
921686790_921686794 -5 Left 921686790 1:218098499-218098521 CCCTCCGACTTCTGCTTACCGTG No data
Right 921686794 1:218098517-218098539 CCGTGAGACATATAGTGTATAGG No data
921686790_921686798 29 Left 921686790 1:218098499-218098521 CCCTCCGACTTCTGCTTACCGTG No data
Right 921686798 1:218098551-218098573 ACACTGGTAGACCAATTACTAGG No data
921686790_921686797 13 Left 921686790 1:218098499-218098521 CCCTCCGACTTCTGCTTACCGTG No data
Right 921686797 1:218098535-218098557 ATAGGAAACAGGGTAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921686790 Original CRISPR CACGGTAAGCAGAAGTCGGA GGG (reversed) Intergenic
No off target data available for this crispr