ID: 921694360

View in Genome Browser
Species Human (GRCh38)
Location 1:218190627-218190649
Sequence GATTTTGCCACAAGGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921694356_921694360 18 Left 921694356 1:218190586-218190608 CCAGTTTTACAGAATTACTGGCT No data
Right 921694360 1:218190627-218190649 GATTTTGCCACAAGGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921694360 Original CRISPR GATTTTGCCACAAGGATGGA TGG Intergenic
No off target data available for this crispr