ID: 921695541

View in Genome Browser
Species Human (GRCh38)
Location 1:218204899-218204921
Sequence TTGGAAATACAGAAGAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921695541_921695542 -10 Left 921695541 1:218204899-218204921 CCAAACTTCTTCTGTATTTCCAA No data
Right 921695542 1:218204912-218204934 GTATTTCCAATCTTCCTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921695541 Original CRISPR TTGGAAATACAGAAGAAGTT TGG (reversed) Intergenic
No off target data available for this crispr