ID: 921703757

View in Genome Browser
Species Human (GRCh38)
Location 1:218296070-218296092
Sequence AGGTAAAATCAGAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 395}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921703754_921703757 7 Left 921703754 1:218296040-218296062 CCTTGAATAACTAGGGGGATATG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG 0: 1
1: 0
2: 4
3: 25
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921703757 Original CRISPR AGGTAAAATCAGAATGAGGA TGG Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900797472 1:4717441-4717463 AGGTAAACCCTGAATGATGATGG - Intronic
902953614 1:19908350-19908372 AAATAACATCAGAATCAGGAAGG - Exonic
903749545 1:25612267-25612289 AGCTAAGATCAGAGAGAGGAAGG - Intergenic
905021593 1:34818731-34818753 ATCTAAAATCAGAATGAGGCCGG + Intronic
906097410 1:43233745-43233767 AGGTAAAAGCATGATGAAGAGGG + Intronic
907575020 1:55518635-55518657 AGGTGAAATCAGAGGGAGGAAGG + Intergenic
908341545 1:63185326-63185348 AGGAAACATCAGAAACAGGAAGG - Intergenic
909401507 1:75236935-75236957 AGATAAAATCAGAATGGGGCTGG + Intronic
909829070 1:80162590-80162612 AGGAAACAGCAGAAGGAGGATGG + Intergenic
910278635 1:85474416-85474438 GGATGAGATCAGAATGAGGATGG - Intronic
910292310 1:85611498-85611520 AAGTTACATCAGAGTGAGGAGGG + Intergenic
910778184 1:90897321-90897343 AGGAAAAATCAGAATAACGTTGG - Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
912209971 1:107546597-107546619 AGGTAAACACAGAAGGTGGATGG - Intergenic
912214210 1:107589114-107589136 AAGAAAAATTAGAATAAGGATGG + Intronic
913472088 1:119198498-119198520 AAATAAAATCAGAATGAAAAAGG + Intergenic
914344632 1:146788053-146788075 AGTTAGAGTCAGAATGAGGTAGG - Intergenic
914906918 1:151753932-151753954 AGGAAATATCATAGTGAGGAAGG + Intergenic
915020426 1:152774182-152774204 AGGTAAAATAAAGATGAGAAGGG - Intronic
915090471 1:153420733-153420755 AGGTGGAATGAGAATGAGAAAGG - Exonic
915095019 1:153456370-153456392 AGGTGGAATGAGAATGAGAAAGG + Intergenic
915322984 1:155066166-155066188 CGGTAAAAAAAGAATGAGGGAGG - Intronic
917225844 1:172781535-172781557 AGGAAAAAGAAGAATGAAGAAGG - Intergenic
917710855 1:177682682-177682704 AAGCAAAATGAGAATGAGAAAGG - Intergenic
917831577 1:178895537-178895559 AGCTGAGATCTGAATGAGGAAGG + Intronic
918046088 1:180941845-180941867 TGTTAAAAGAAGAATGAGGAGGG - Intronic
918174526 1:182031194-182031216 AGGTAAAATAAGCATTAGGAAGG - Intergenic
918304311 1:183232152-183232174 AGGAAAGATCAGAACGAGGGTGG - Intronic
918895385 1:190336894-190336916 AGGTAAAGTCAGAAGAAGGAAGG - Intronic
919270988 1:195344776-195344798 ATATAAATTCAGAATCAGGATGG + Intergenic
919537611 1:198807762-198807784 AGGTAAGAGCACAATGAGAATGG + Intergenic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
921795415 1:219338067-219338089 ACGTAAAATGAGAATGAGGAAGG - Intergenic
922202551 1:223418433-223418455 TGGTAAATTCAGCATGGGGAGGG + Intergenic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
923146529 1:231202439-231202461 AGGTGAGAGCAGAATGAGCAAGG + Intronic
923761080 1:236844792-236844814 AGGTCAACTCAGAGTGAGAATGG + Intronic
924256899 1:242191807-242191829 AGGTACAGAGAGAATGAGGAGGG + Intronic
924610605 1:245570477-245570499 AGGTAAGACCAGCATGTGGAAGG - Intronic
924866010 1:247981318-247981340 AGGTAAAGGCAAAATGAGAATGG + Intronic
1064031038 10:11883041-11883063 AGGTAGAATGACAATGAAGATGG + Intergenic
1064978643 10:21144427-21144449 AAATAAAATCAGAATGGGGCCGG + Intronic
1065004058 10:21363325-21363347 AGGTTAAGTTAGAATCAGGATGG - Intergenic
1065182728 10:23143214-23143236 AGTTAAAATAAGGAGGAGGATGG + Intergenic
1065882100 10:30045753-30045775 GGGGAAAATCACAATGAAGAAGG - Intronic
1066497979 10:35960746-35960768 AGGGATATTCCGAATGAGGAAGG + Intergenic
1067234494 10:44436517-44436539 AGGTAAAATCATGCTGAGAAGGG - Intergenic
1068339144 10:55678386-55678408 AGGTCACCTCAGAAGGAGGAAGG + Intergenic
1068638594 10:59375727-59375749 TAGTAAAATCAGATTGATGAAGG + Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1070102223 10:73399150-73399172 TGGTAGGATCAGAATAAGGAAGG + Intronic
1070385633 10:75921836-75921858 AGGAAGGATCAGAAGGAGGAAGG - Intronic
1070592041 10:77808240-77808262 AGGCAACATCAGCAAGAGGAAGG - Intronic
1070976409 10:80609304-80609326 AGGTAAAAGGAGGAGGAGGAAGG - Intronic
1071702965 10:87962055-87962077 AGGTAGAATAAGAAATAGGAAGG - Intronic
1072363682 10:94686791-94686813 AGGTAGAATCAAAATGATAAAGG + Intronic
1072478029 10:95782392-95782414 AGGTATGTCCAGAATGAGGAAGG + Intronic
1073161575 10:101402099-101402121 TGGTAAATTCATAATTAGGAAGG + Intronic
1074197912 10:111205612-111205634 TGGAAAAATCAGAAGAAGGAAGG - Intergenic
1074568512 10:114603142-114603164 AGGTAAAACCAGGTTGAGCAGGG + Intronic
1075242159 10:120788912-120788934 TGGTAACATGAGAATGATGATGG + Intergenic
1075483792 10:122803660-122803682 ACCTAAAGTCAGAATTAGGAAGG + Intergenic
1076273387 10:129175877-129175899 AGGTGAGATCATAATGAAGAAGG - Intergenic
1078322801 11:10352012-10352034 GGGTAAAATGATTATGAGGAAGG + Intronic
1078792806 11:14561598-14561620 AGGTAACATGAGAGTGAGGAGGG - Intronic
1079236514 11:18694601-18694623 AGGCAAGCTCAGAATGATGATGG + Intronic
1080023288 11:27586938-27586960 TGGTAAAAAAAGAATGAAGAAGG - Intergenic
1080084965 11:28268443-28268465 ATGTACAATCAGAATGATAATGG - Intronic
1080278581 11:30530662-30530684 AGGGAAAATCAGAAATAAGAAGG + Intronic
1080759905 11:35238393-35238415 AGGTAAAACCAGAAAGAAGAGGG + Intergenic
1081174886 11:39915103-39915125 AGGAAAAATCAAACTGAGAAAGG + Intergenic
1081868086 11:46370638-46370660 AGGGAAAATCCGAGTGAGGCAGG + Intronic
1081878843 11:46430434-46430456 ACCTAAAATCAGAATAAGAATGG - Intronic
1082763299 11:57146957-57146979 AGGTAAAATGACAATGATGTGGG - Intergenic
1082843488 11:57708809-57708831 AGCTACAATCAGAATAGGGAAGG + Intronic
1082914851 11:58422140-58422162 ATGTAATACCTGAATGAGGAAGG - Intergenic
1084110062 11:67008260-67008282 AGGAAAAATCAGATTAAGAAGGG - Intronic
1085802404 11:79602515-79602537 AAGTAAAATGGAAATGAGGAAGG + Intergenic
1085816133 11:79739198-79739220 AGATGAAATGAGAAGGAGGAGGG - Intergenic
1085899892 11:80686472-80686494 AGTTAAGATTAGAAGGAGGAAGG - Intergenic
1087066149 11:94029830-94029852 AGGCAAAATAAGTATCAGGAGGG - Intronic
1087344899 11:96959478-96959500 AGCCAAAATCAGAGTGAGGAAGG + Intergenic
1089036536 11:115399680-115399702 TGTTAAAAAAAGAATGAGGATGG - Intronic
1089847443 11:121469401-121469423 CGATAAAATAAAAATGAGGAAGG - Intronic
1089932986 11:122333186-122333208 AGTGAAAAACAGAATGAGGTGGG - Intergenic
1090894009 11:130953089-130953111 AGGAAAAGACAGAAGGAGGAAGG - Intergenic
1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG + Intronic
1092658999 12:10718822-10718844 AGATAAAATCAGAAATGGGAAGG - Intronic
1093683805 12:22032957-22032979 AGAAAAAAACAGAAGGAGGAAGG + Intergenic
1093725909 12:22508339-22508361 AGGGAAAATAAGGAAGAGGATGG + Intronic
1093859826 12:24150959-24150981 ATTTAAAAACAGAATCAGGAAGG + Intergenic
1094171490 12:27497442-27497464 TGGTAAAATCAGATGGAGGCTGG + Intronic
1094353557 12:29553276-29553298 CGGTAAAATGGGGATGAGGAAGG + Intronic
1095203691 12:39415178-39415200 AGTTAAATTCAAAATCAGGACGG + Intronic
1095267116 12:40173566-40173588 AGGTGAAAACAGAATTAGAAAGG + Intergenic
1096247306 12:49999012-49999034 GAGTAAAATTGGAATGAGGAAGG + Intronic
1096448275 12:51715020-51715042 AGGAAAATTGAGATTGAGGAAGG + Intronic
1096511009 12:52128548-52128570 AAATAAAATCACAATGAGGCCGG + Intergenic
1097604135 12:61731556-61731578 AAGTAAAAGAAGAATGAGCAGGG - Intronic
1098472030 12:70856392-70856414 AGGGCAAGTCAGAATGAGCATGG + Intronic
1098997880 12:77142792-77142814 AGGAAAGAAGAGAATGAGGAGGG - Intergenic
1099465982 12:82988563-82988585 AGTTGAAGGCAGAATGAGGAGGG + Intronic
1100020015 12:90057734-90057756 AGGCAAAATCAGAATGGCGTAGG + Intergenic
1100799505 12:98216467-98216489 GGGTGAAAGCAGAATGAGTAAGG - Intergenic
1101221825 12:102649615-102649637 AAGAAATATGAGAATGAGGATGG + Intergenic
1101483725 12:105129731-105129753 AGGGACATTCAGAATGAAGAGGG + Intronic
1102053801 12:109881094-109881116 AGGTAACATCAGACTGTTGAGGG - Intergenic
1102213024 12:111140674-111140696 AGGCAAAATCAGAATAGGGGTGG + Intronic
1102272078 12:111545664-111545686 AGGAAAAATAATAATGAGGCCGG + Intronic
1104514792 12:129415148-129415170 AGATAAAATCAGCATGCTGAAGG - Intronic
1107063716 13:36189086-36189108 AGGAAGAATCAGCATGAGCATGG - Intronic
1109286489 13:60415220-60415242 AGGAAAAATATGAATGAGAATGG - Intronic
1109496540 13:63178955-63178977 AGGCAAAGAGAGAATGAGGAAGG - Intergenic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1110968191 13:81727594-81727616 AGGTAAAATCAAAATAATTAAGG + Intergenic
1111683353 13:91470914-91470936 CAATAAAATCAGAATGAGAAAGG - Intronic
1112049409 13:95631157-95631179 ATTTAAGATCAGAATGAGGTCGG + Intronic
1112071717 13:95859365-95859387 AAGTAAAATCAAAATCAGAATGG - Intronic
1112811141 13:103220539-103220561 AGGTAAAATCAGCAAGCTGAAGG - Intergenic
1113002236 13:105654600-105654622 AGGAAAAATGTAAATGAGGATGG + Intergenic
1113028585 13:105969230-105969252 TGGTCAAATCAAAATCAGGAAGG - Intergenic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1113291172 13:108908193-108908215 TGGTAAAATTAGAATGGGGGTGG - Intronic
1114217931 14:20671284-20671306 AGGAAAAATCAGGAGGGGGATGG - Intergenic
1114487987 14:23075517-23075539 AGGCACAATCAGAATCAGAATGG + Intronic
1114918785 14:27299840-27299862 AGATAAAATCAGAATGAAGGGGG - Intergenic
1115349151 14:32374513-32374535 GGGTCAAATCAGTAGGAGGATGG + Intronic
1116378825 14:44238438-44238460 AGCTAAAATTATAATGAGAACGG + Intergenic
1118413355 14:65505735-65505757 AAGTCAAATGAGAATGAAGATGG - Intronic
1118692183 14:68350899-68350921 AAGTAAAATCACAAATAGGATGG + Intronic
1119956359 14:78802618-78802640 CGGTAACCTCAGACTGAGGAAGG + Intronic
1120873756 14:89360413-89360435 AGGTAAAAAGAGAGGGAGGAAGG + Intronic
1121229635 14:92347390-92347412 AGGCAAAATAACAGTGAGGAAGG + Intronic
1122001576 14:98661061-98661083 ATGTAAAATAAGAATAAGCAAGG + Intergenic
1122284493 14:100642559-100642581 AGGTCATATCAGAATAAGGTGGG + Intergenic
1122569030 14:102681750-102681772 ACTTAACATCAGAGTGAGGATGG - Intronic
1123792733 15:23738583-23738605 AGTTAAAACCACAATGAGGCCGG - Intergenic
1125076924 15:35630315-35630337 AAGTAAAAAAAGAAGGAGGATGG + Intergenic
1125439201 15:39683431-39683453 AGGTGTTATCAGAATGAAGAAGG - Intronic
1125450263 15:39800455-39800477 AGGGAAAATCAGAATTATCAAGG + Intronic
1126666462 15:51079692-51079714 AAGTCAAATCAGACTGAGCATGG + Intronic
1127124404 15:55798114-55798136 AGTTAAAATAAGAAAGAGAAAGG + Intergenic
1127278516 15:57468892-57468914 AGGCAAAGAGAGAATGAGGAAGG - Intronic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1128720752 15:69946636-69946658 AGGTAGAATAAGAATCAAGAAGG + Intergenic
1129016309 15:72472394-72472416 AGGTAATATCACAATGGAGACGG + Intergenic
1129638676 15:77351376-77351398 AAGTATGATCAGAATGAGGCAGG + Intronic
1131823934 15:96301281-96301303 AGGCAAAATGTGGATGAGGAGGG + Intergenic
1132104334 15:99051775-99051797 AGGTAAACTCAGACAGGGGATGG - Intergenic
1133698284 16:8285873-8285895 AGGTAAAAAGAGAGGGAGGATGG - Intergenic
1134170658 16:11966499-11966521 TGTCAAAATCAGAATGAAGATGG - Intronic
1134194837 16:12151664-12151686 ATGTAAAACCATAATGAGGAGGG - Intronic
1135311807 16:21410995-21411017 AGCTAAAATCCGTAAGAGGAAGG - Intronic
1135364758 16:21843447-21843469 AGCTAAAATCCGTAAGAGGAAGG - Exonic
1135447084 16:22527890-22527912 AGCTAAAATCCGTAAGAGGAAGG + Exonic
1136150975 16:28348895-28348917 AGCTAAAATCCGTAAGAGGAAGG - Exonic
1136167209 16:28462735-28462757 AGCTAAAATCCGTAAGAGGAAGG - Exonic
1136195768 16:28652281-28652303 AGCTAAAATCCGTAAGAGGAAGG + Exonic
1136212106 16:28766406-28766428 AGCTAAAATCCGTAAGAGGAAGG + Exonic
1136256825 16:29046334-29046356 AGCTAAAATCCGTAAGAGGAAGG + Exonic
1136308510 16:29390002-29390024 AGCTAAAATCCGTAAGAGGAAGG - Exonic
1136321926 16:29491528-29491550 AGCTAAAATCCGTAAGAGGAAGG - Exonic
1136436607 16:30231501-30231523 AGCTAAAATCCGTAAGAGGAAGG - Exonic
1137352795 16:47728544-47728566 AGGAAAAATCCAAATGAAGAAGG - Intergenic
1137514611 16:49132359-49132381 AGGGAATATGAGGATGAGGAAGG + Intergenic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1139989360 16:70927253-70927275 AGTTAGAGTCAGAATGAGGTAGG + Intronic
1140366517 16:74385666-74385688 AGCTAAAATCCGTAAGAGGAAGG + Exonic
1140816830 16:78628896-78628918 AGATAAATGCACAATGAGGAGGG - Intronic
1141164436 16:81651087-81651109 AGCCAAAGTCAGAAAGAGGAGGG - Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143121938 17:4613567-4613589 AGGTAAAAAGAAAAGGAGGAAGG - Intergenic
1144530876 17:16038027-16038049 AGGTAAGAACAGAAAGGGGAAGG + Intronic
1145068193 17:19778505-19778527 AGAGAAAATCAGAATGTCGATGG - Intronic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1148725389 17:49786072-49786094 AGGTATATTTAGAATGGGGAAGG - Intronic
1153261662 18:3230266-3230288 AGCTAAAATGAAAATGAGGCAGG + Intergenic
1153717247 18:7862612-7862634 AAGTAAAATGGGAAAGAGGAAGG + Intronic
1153923174 18:9809144-9809166 AGGTAAAAACAGGCTCAGGATGG - Intronic
1154117683 18:11625637-11625659 AGCTAAAATCCGTAAGAGGAAGG - Intergenic
1154167916 18:12029740-12029762 TGGTAAAATCAGAGTGATGGGGG - Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1157012614 18:43669605-43669627 AAATTAATTCAGAATGAGGAAGG + Intergenic
1157107219 18:44785673-44785695 AGGTAAAATCAGCAAGGAGATGG - Intronic
1157543338 18:48528838-48528860 CTGTAAAATGAGAATGATGATGG + Intergenic
1157791831 18:50538972-50538994 AGTTAAAACCAAAATGAGGATGG - Intergenic
1158795381 18:60839546-60839568 AGGGAACCACAGAATGAGGATGG + Intergenic
1159338860 18:67108199-67108221 AGGTAGAATAATAATGAAGAAGG + Intergenic
1159652062 18:70988951-70988973 TGATAAAATCACCATGAGGAAGG - Intergenic
1161712293 19:5855707-5855729 AGGTAAAAGCAAAAAGAGGCTGG - Intergenic
1162010056 19:7807667-7807689 AGGTAAAATGAGAATGAGGGCGG - Intergenic
1164969459 19:32518888-32518910 AGAGAAAATCAGAGTGAGAAGGG - Intergenic
1164988394 19:32666300-32666322 AGATAAAATAAGAATCAGTATGG + Intronic
1165613949 19:37182318-37182340 AGGTAAAATGGGAATAATGAAGG + Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166252487 19:41580911-41580933 AGGCAACTTCAGAATGAGGCTGG - Intronic
1166591153 19:44000483-44000505 AGGCAAAAGCAGTAGGAGGAGGG + Intergenic
1166931399 19:46303686-46303708 AGGTAAAATCAGGGCTAGGAAGG + Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167798391 19:51725403-51725425 AGGTAAAAGCAGAGAGAGAATGG - Intergenic
1168397364 19:56059995-56060017 AGGTGAAGACAGGATGAGGAAGG + Intronic
925062427 2:903575-903597 AGGGTAAATCAGAAGGAAGAAGG - Intergenic
926542826 2:14202876-14202898 AGGTAAAATAAGAAAGAAGGTGG + Intergenic
926640745 2:15233743-15233765 AGGTAAAAACTGTATGAGGCTGG + Intronic
927306246 2:21576736-21576758 AGATAAAGTCAGTTTGAGGAAGG + Intergenic
928120934 2:28582991-28583013 AGGTCAAACCAGAATTAGCAGGG + Intronic
928816412 2:35300156-35300178 AGGGACAATGAGAGTGAGGAGGG - Intergenic
929249488 2:39737444-39737466 AGGAAAAATCAGAAAAAGAAGGG + Intronic
929576322 2:43055079-43055101 GGGTAGAGTCAGCATGAGGATGG + Intergenic
929868832 2:45740772-45740794 AGGTAGAATCAGAATGAGGCAGG - Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
929957251 2:46467529-46467551 TGGAGAAATCAGACTGAGGAGGG - Intronic
930539245 2:52683745-52683767 AGCTAACATCAGAATGAACAAGG + Intergenic
931786332 2:65622425-65622447 AGGGGAAAAGAGAATGAGGAGGG + Intergenic
931794765 2:65698782-65698804 AGGAAAAATGAGAAAAAGGAGGG - Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
934999140 2:98994602-98994624 AGTTAAAATAAGAAAGAAGATGG + Intergenic
935551182 2:104457066-104457088 ATGTAAAATGAAAATGAGTATGG - Intergenic
936268604 2:111030929-111030951 GAGTAAAATAAGAATGAAGAAGG - Intronic
936342165 2:111643304-111643326 AGAGAAAATTAGAAGGAGGAAGG - Intergenic
937482787 2:122279958-122279980 TGATAAAATCAGAACGTGGAGGG - Intergenic
937715979 2:125033092-125033114 ATGTAAAAACAAAGTGAGGAAGG - Intergenic
939767355 2:146267376-146267398 TGGTGAAAGCAGGATGAGGAAGG + Intergenic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
939995019 2:148911920-148911942 AGGAAAAATCAGTGTGATGAGGG - Intronic
940355196 2:152733718-152733740 AGGTAACATCAGAATTCAGATGG - Intronic
940664847 2:156596021-156596043 AGGCAAAAACACAATGAGAAAGG - Intronic
941155751 2:161975903-161975925 AGGTGAAATCAGAGTGAGGTGGG + Intronic
941191947 2:162395582-162395604 AGGCAAAGTCAGAATGAGGGTGG + Intronic
941479244 2:165985343-165985365 AGGTAAAGTAAGAAAAAGGAAGG + Intergenic
941920987 2:170850524-170850546 AGGTAGAAGCAGACTAAGGAGGG + Intronic
942346725 2:175010823-175010845 AGATAAAAGAAGAATGATGATGG + Intergenic
942425730 2:175858529-175858551 TGGTAAAATCTGAATAAGGTGGG - Intergenic
942648214 2:178137822-178137844 AGCAAAAATCAGCATGAGGCTGG + Intronic
942881044 2:180860628-180860650 AGGAAAAAGGAGAATGAGAAAGG + Intergenic
944053782 2:195501496-195501518 TGGTAAAATCTGAATGTGAATGG + Intergenic
948433709 2:237937620-237937642 AAATAAAACCAGAAAGAGGAGGG + Intergenic
1168945714 20:1755562-1755584 AGGTAAAATCAGAGTCATGATGG - Intergenic
1170089891 20:12579300-12579322 TAGAAAAATCAGGATGAGGAAGG - Intergenic
1170578027 20:17679402-17679424 TGGTCAAGTCAGAATGATGAAGG - Intronic
1174234683 20:49079728-49079750 ATGTAAAATCTGTATGTGGAAGG - Intronic
1174254445 20:49243778-49243800 AGTTAAGACCAGAATGAGGATGG - Intronic
1175275755 20:57769527-57769549 AGGTAAAAGCACTGTGAGGAAGG + Intergenic
1176805337 21:13475903-13475925 AGGTAAAATTAAAATGATGGTGG + Intergenic
1177166357 21:17609244-17609266 AGATAAAATTGGAAGGAGGAAGG - Intronic
1177412446 21:20747719-20747741 CAGTAAAGTCAGAGTGAGGAAGG - Intergenic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1178295519 21:31406788-31406810 AGGTGAAAATTGAATGAGGAGGG - Intronic
1178465541 21:32844126-32844148 AGGCAAAAGCAGACTGGGGATGG - Intergenic
1182371777 22:29816286-29816308 AGGTTAAATCATACTGAGCAAGG - Intronic
1183283283 22:36945610-36945632 AGGCAAAGAGAGAATGAGGAAGG + Intergenic
1185020426 22:48371422-48371444 AGGTAAAATGAGACTGAGTCTGG - Intergenic
949842115 3:8331147-8331169 AGATAAAGTCAGAATGATAATGG - Intergenic
950177861 3:10888390-10888412 AGGAAGAATCTGACTGAGGATGG + Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
952659707 3:35830863-35830885 AGGCAATATAAGAATGAGAACGG + Intergenic
953183327 3:40616334-40616356 AGCTAATATCATAATGAGGTTGG + Intergenic
953285586 3:41604206-41604228 TGGTAAAAGCATAATCAGGAAGG + Intronic
953500001 3:43424101-43424123 GGGCAAAGTCAGAATGAGGCTGG - Intronic
955338679 3:58107965-58107987 AGGTCAACTCAGAATAAGGCAGG + Intronic
956661862 3:71606844-71606866 AGTTAAAACCACAATGAGAACGG + Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
957842853 3:85693589-85693611 AGAAAAAATCAGAAGGAGGCTGG + Intronic
957881820 3:86225151-86225173 AGGTAAAATCTTCATGATGATGG + Intergenic
957906707 3:86566728-86566750 AGGCAAAATGACAATGAAGAAGG + Intergenic
957969874 3:87368982-87369004 ATGGAAGATCAGAATCAGGAGGG - Intergenic
958499774 3:94890141-94890163 AAGTAACATCAGAATTAGCAAGG - Intergenic
960031056 3:113055523-113055545 GGGTAAATTCAGAAAGAGAATGG + Intergenic
960780977 3:121316296-121316318 AGGTAAATTCAGAAGGAGCTAGG + Intronic
961445814 3:126980967-126980989 AGTTAAAACCACAATGAGGCTGG + Intergenic
963974762 3:151468322-151468344 ATTTAAAATGAGAATGAGAAAGG - Intergenic
964212507 3:154244253-154244275 ATGTAAAATCAGCAGTAGGAGGG + Intronic
965553478 3:169995544-169995566 ATGTAAAACCAGAAAGAGGGGGG - Exonic
965830691 3:172784714-172784736 AAGCAAAACCAGAATGTGGACGG + Exonic
966531983 3:180991263-180991285 AGGTATCATGAGAATGAGGAAGG - Intergenic
967826979 3:193884859-193884881 AGAGGACATCAGAATGAGGAGGG - Intergenic
967869027 3:194214424-194214446 AGGTAAACCAAGAAGGAGGAAGG + Intergenic
968146013 3:196299550-196299572 AGGTAAAATCAGATTCTGGAGGG + Intronic
970553098 4:17203930-17203952 TGGAAAAATCAGAAGGAAGAGGG + Intergenic
971165935 4:24183680-24183702 AGGAAAGAGCAGAGTGAGGAAGG - Intergenic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
975797911 4:78028559-78028581 AGCTAAAATCAATATGAGGGAGG + Intergenic
977270274 4:94909651-94909673 ATGTAAAATCAGGAAGAGGGAGG - Intronic
978806008 4:112801103-112801125 GTGTGAATTCAGAATGAGGAGGG + Intergenic
980538038 4:134154707-134154729 ACTTAAATTCAGAATGAGCAAGG - Intergenic
981454758 4:144940567-144940589 CGGTAGAATAGGAATGAGGATGG - Intergenic
981491158 4:145340792-145340814 ATGTTAAATAAGGATGAGGATGG + Intergenic
981995814 4:150974007-150974029 AGGCAAAATAACAATGAGTACGG + Intronic
982267179 4:153548697-153548719 AGGTAAAGGCAGAAAGTGGAGGG + Intronic
982318986 4:154059560-154059582 AGGTAAAAGCAAAGAGAGGATGG - Intergenic
982445760 4:155489161-155489183 AGGGAAAATGAGAACAAGGAAGG - Intergenic
982472619 4:155811608-155811630 AGCTAAAATCAAAATGACTAAGG + Intergenic
982676323 4:158380451-158380473 AGGCCCAATCAGAATGAAGAAGG + Intronic
983712051 4:170730277-170730299 AAATAAAATAAAAATGAGGATGG + Intergenic
985012218 4:185594868-185594890 GGGTAAAATCAGAATTTGCATGG + Intronic
985837146 5:2279963-2279985 AATTATAATCAGAATCAGGAAGG - Intergenic
986656724 5:10020186-10020208 TTGTAAAATAGGAATGAGGATGG + Intergenic
987689395 5:21247023-21247045 ATGTAAAATCAGAATATGTATGG - Intergenic
988051756 5:26040872-26040894 AGAAAACATCAGAATAAGGAAGG + Intergenic
988618051 5:32794211-32794233 AGTTCAGTTCAGAATGAGGATGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990172697 5:53071742-53071764 GGCTAAAAGCAGAATTAGGATGG + Intronic
991619746 5:68533245-68533267 AGGTGAAAAGAGAGTGAGGAGGG + Intergenic
992819444 5:80481309-80481331 AGGTAAGATCACAAATAGGAGGG + Intergenic
993384658 5:87250775-87250797 AGGGAAAAGCAAATTGAGGAAGG - Intergenic
993530600 5:89019998-89020020 AGATAAACTCAGAATGAATATGG - Intergenic
993948976 5:94150110-94150132 AGGAAACATTAGAATAAGGAAGG - Intergenic
994008291 5:94867958-94867980 AGATAAAATCAAATTGAGAATGG + Intronic
994128625 5:96198225-96198247 AGGTAAAACCAGATTGAGCATGG - Intergenic
994239003 5:97398645-97398667 ATGTTAGATCAGAATGATGAAGG + Intergenic
994948300 5:106424448-106424470 AGATAAAATCAGAAAGAAAAAGG - Intergenic
996306757 5:122055770-122055792 AATTAAAAACACAATGAGGATGG + Intronic
998514470 5:142740128-142740150 AGATAAAAGAAGAAAGAGGAAGG - Intergenic
998662625 5:144256968-144256990 TAGTAAAATCAGAATGTGGAAGG + Intronic
998678636 5:144439010-144439032 AGATGAAATTAGAACGAGGAAGG - Intronic
998862087 5:146454233-146454255 AGACAAACTCAGAATAAGGAAGG - Intronic
1002651041 5:180694434-180694456 AAGTAAAATCAGAATGAAAGAGG + Intergenic
1002811633 6:636756-636778 AGATGCATTCAGAATGAGGAAGG - Intronic
1007366612 6:41398515-41398537 AGTTGAAATTAGAAAGAGGAAGG - Intergenic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1008123143 6:47640753-47640775 AGATAAAACCAGAAAGATGATGG - Intergenic
1008226632 6:48926909-48926931 AGGGTAAATCAAAATCAGGAAGG + Intergenic
1008326394 6:50187350-50187372 AGGCAGAATGACAATGAGGATGG - Intergenic
1008877800 6:56348517-56348539 TGGTAAAATGAGAATAAGGAGGG + Intronic
1009417905 6:63436145-63436167 AGGAAAAAAGAGAATGAAGATGG - Intergenic
1010853492 6:80807489-80807511 AGTTAGTATGAGAATGAGGAAGG + Intergenic
1011635006 6:89363446-89363468 AGGTCAAAAAAGAATTAGGATGG + Intergenic
1011869636 6:91876504-91876526 AGGTAAAAGCATAAGGAGAAGGG + Intergenic
1012271693 6:97220279-97220301 AGGTAAAAGAAGACTGTGGATGG + Intronic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1013902233 6:115171133-115171155 AGGGAAAATCAGCATGAGTCAGG - Intergenic
1014618073 6:123629064-123629086 AGGTTAAATCAGAATAACCATGG + Intronic
1017092335 6:150771114-150771136 AAGAAAAATAAGAATGAGGGTGG + Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1018005217 6:159615794-159615816 TGGGGAAATAAGAATGAGGAAGG + Intergenic
1019448324 7:1082917-1082939 AGATAAAATCAGACTGAGGTGGG + Intronic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1021305261 7:19023931-19023953 AAGTAAAAGCAGAACGTGGATGG + Intronic
1021964295 7:25902331-25902353 AGCTAAAATCAGTCTGTGGAAGG + Intergenic
1022018926 7:26379500-26379522 AAGAAAAATAAGAATGAAGAGGG - Intergenic
1023332612 7:39134498-39134520 ATGTAAAGACAGAATGAAGAAGG - Intronic
1026462808 7:70629728-70629750 AGGTAAATTTAGAATTAGGTGGG - Intronic
1027252514 7:76408189-76408211 AGGTAAAGCCAGAGAGAGGAGGG - Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027522068 7:79221606-79221628 AGGTAAAATCATACTGGGGAAGG + Intronic
1027531910 7:79345158-79345180 AGATAAAATCATACTGAGTAGGG + Intronic
1028543360 7:91970223-91970245 AAGTAAAGTCAAAATGTGGAGGG - Intronic
1029033986 7:97499343-97499365 AGGGAAAACCAGATTGGGGAGGG + Intergenic
1030551372 7:110964778-110964800 AGGAAAAAATAGAAAGAGGAAGG - Intronic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1032592540 7:133205590-133205612 AGATAAAATCAAAATAAGGCTGG + Intergenic
1033415135 7:141155332-141155354 AGGGAAAAACAGAATTAGCAAGG - Intronic
1034427425 7:151021404-151021426 AGGAAAAACCATCATGAGGAGGG + Intronic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035646370 8:1224251-1224273 AGGGAATATCAGGATGAGTAAGG + Intergenic
1037706710 8:21321542-21321564 AGGGAACATAAGAATGAAGATGG - Intergenic
1038135361 8:24779962-24779984 AGCTAAAACCAGAAAGATGAAGG + Intergenic
1038625189 8:29185727-29185749 ATGTAAAAACAGCATTAGGAAGG - Intronic
1039261995 8:35781902-35781924 AGGTAAAAGGATAATGATGAGGG + Intronic
1039770544 8:40682334-40682356 AGGTAAAATGAGTTGGAGGAAGG + Intronic
1040728397 8:50411489-50411511 AAATAAAAACAGAAGGAGGAAGG + Intronic
1040822682 8:51581920-51581942 AGGTAAAAAAAGATTGATGAGGG - Intronic
1041321249 8:56615151-56615173 AGGAAAAAAGAGAAAGAGGAAGG - Intergenic
1041842425 8:62287778-62287800 GGTTAGAATCAGAATGTGGAAGG - Intronic
1041916757 8:63146271-63146293 AGGTGGAATCAGGAGGAGGAGGG + Intergenic
1041982158 8:63874478-63874500 AGGGAAGATCAGAAAGAAGAGGG + Intergenic
1042081942 8:65063388-65063410 AGTTATATTCTGAATGAGGAAGG + Intergenic
1044425714 8:92047397-92047419 ATGGAAAATCAGGATAAGGAGGG - Intronic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044697142 8:94934711-94934733 AGGTAAAATCATAATCAGAAGGG + Intronic
1044714907 8:95091302-95091324 AGGAAAAACAAGAGTGAGGAGGG + Intronic
1045271475 8:100665495-100665517 AGGTAACATGAAAACGAGGATGG - Intergenic
1045868975 8:106903826-106903848 AGATAAACTCAGAATGAATATGG - Intergenic
1046689178 8:117263496-117263518 AGGCAAAGAGAGAATGAGGAAGG - Intergenic
1047146936 8:122212406-122212428 AGGTAAAATTAGAAAGATAAGGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1050360792 9:4829200-4829222 AGGGAAAATCAGAATCAGTCTGG + Intronic
1050502438 9:6313270-6313292 AGGCAAAGAGAGAATGAGGAAGG + Intergenic
1050538467 9:6649984-6650006 AGCCAAAAGCAGATTGAGGAGGG + Intergenic
1051135103 9:13911186-13911208 AGGTGACCTCAGAATGAAGAAGG - Intergenic
1051564506 9:18482067-18482089 AGGTATAATTCTAATGAGGATGG - Intronic
1055018572 9:71645216-71645238 AGATAAATTGAGAATAAGGAAGG - Intergenic
1055114521 9:72592515-72592537 GGGTAAATTCTGAAGGAGGAGGG - Intronic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1056648418 9:88435628-88435650 ATGTAATATCAGAAAAAGGAAGG - Intronic
1057357859 9:94346536-94346558 AAGTAAAGTCAGAAGTAGGACGG + Intergenic
1057544398 9:96006646-96006668 AGGTGAAAACAGAAAGAGGGAGG + Intronic
1057649890 9:96911073-96911095 AAGTAAAGTCAGAAGTAGGACGG - Intronic
1058593967 9:106595025-106595047 AAGTAAAAACAAAATGAAGAAGG - Intergenic
1059872631 9:118594977-118594999 TGGTCTAATGAGAATGAGGAAGG + Intergenic
1060397361 9:123325527-123325549 GGGTCAAGTCAGAATGTGGAAGG + Intergenic
1186108834 X:6233738-6233760 AGGTAAATTCAGAAATAGCAGGG + Intergenic
1186259768 X:7765001-7765023 AAGTAAACTCAGAAAGAGCATGG - Intergenic
1186299602 X:8185419-8185441 GGGTGAATGCAGAATGAGGATGG + Intergenic
1186992104 X:15080971-15080993 AGGGAATATCAAAATGTGGAGGG + Intergenic
1188079722 X:25822241-25822263 AGGCAAAGAGAGAATGAGGAAGG + Intergenic
1188453281 X:30332294-30332316 AGGTAAGATCAGAAGAAGCAGGG + Intergenic
1188459895 X:30412344-30412366 AGATAAAATTAGAAAGAAGATGG - Intergenic
1190408969 X:50115665-50115687 GGGTAGCTTCAGAATGAGGATGG - Intergenic
1191031468 X:55978155-55978177 AGGACAAATCAAAATGAGAATGG - Intergenic
1191078091 X:56477813-56477835 ATGAAATTTCAGAATGAGGAGGG + Intergenic
1192301511 X:69908735-69908757 AGGAGAAATTAGAATGATGAGGG + Intronic
1193911706 X:87314634-87314656 AGGTAAAATAGGGAGGAGGAAGG - Intergenic
1193959154 X:87902045-87902067 AGGACAACTCAAAATGAGGAGGG + Intergenic
1193985966 X:88240641-88240663 AGGTTAAAGCGGTATGAGGAAGG - Intergenic
1195462201 X:105140171-105140193 AGGTAAAAGGAGAATGACTATGG - Intronic
1196087857 X:111705885-111705907 AGGGAAAATCAGGAGAAGGAGGG - Intronic
1196331610 X:114476797-114476819 AGGGAAAAATAGAATGGGGATGG + Intergenic
1197165092 X:123368397-123368419 AGGTAAAAGCAGAAAGAGATGGG - Intronic
1197647949 X:129037797-129037819 TAGTAAATTCAGAGTGAGGAGGG + Intergenic
1198460861 X:136861758-136861780 AAGTAAAAACAAAATGAGGAGGG + Intronic
1198977872 X:142357641-142357663 GGGTAAAATTAGATTGAGTAAGG + Intergenic
1199168419 X:144705543-144705565 AGAGAAAGTCAGAATAAGGAAGG - Intergenic
1199202518 X:145109150-145109172 AGTTAAAATCACAATGTAGAGGG - Intergenic
1199798436 X:151226273-151226295 AGGTAAAAGCTGAGTGAGGCTGG + Intergenic
1202384333 Y:24310239-24310261 ATGTAAACTCAGAATGATTAAGG + Intergenic
1202486451 Y:25359883-25359905 ATGTAAACTCAGAATGATTAAGG - Intergenic