ID: 921706023

View in Genome Browser
Species Human (GRCh38)
Location 1:218323710-218323732
Sequence CATGAGAGGGAGGCCGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1052
Summary {0: 1, 1: 4, 2: 23, 3: 139, 4: 885}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921706023_921706032 3 Left 921706023 1:218323710-218323732 CCCACCTCGGCCTCCCTCTCATG 0: 1
1: 4
2: 23
3: 139
4: 885
Right 921706032 1:218323736-218323758 GTTGGCACCCAAAGTCCGGAGGG 0: 1
1: 18
2: 44
3: 135
4: 232
921706023_921706030 -1 Left 921706023 1:218323710-218323732 CCCACCTCGGCCTCCCTCTCATG 0: 1
1: 4
2: 23
3: 139
4: 885
Right 921706030 1:218323732-218323754 GCTTGTTGGCACCCAAAGTCCGG 0: 5
1: 14
2: 34
3: 78
4: 159
921706023_921706039 13 Left 921706023 1:218323710-218323732 CCCACCTCGGCCTCCCTCTCATG 0: 1
1: 4
2: 23
3: 139
4: 885
Right 921706039 1:218323746-218323768 AAAGTCCGGAGGGGGCCAAGGGG 0: 1
1: 2
2: 3
3: 14
4: 125
921706023_921706031 2 Left 921706023 1:218323710-218323732 CCCACCTCGGCCTCCCTCTCATG 0: 1
1: 4
2: 23
3: 139
4: 885
Right 921706031 1:218323735-218323757 TGTTGGCACCCAAAGTCCGGAGG 0: 1
1: 9
2: 43
3: 79
4: 212
921706023_921706042 18 Left 921706023 1:218323710-218323732 CCCACCTCGGCCTCCCTCTCATG 0: 1
1: 4
2: 23
3: 139
4: 885
Right 921706042 1:218323751-218323773 CCGGAGGGGGCCAAGGGGGCAGG 0: 1
1: 2
2: 38
3: 162
4: 610
921706023_921706033 4 Left 921706023 1:218323710-218323732 CCCACCTCGGCCTCCCTCTCATG 0: 1
1: 4
2: 23
3: 139
4: 885
Right 921706033 1:218323737-218323759 TTGGCACCCAAAGTCCGGAGGGG 0: 3
1: 27
2: 82
3: 162
4: 248
921706023_921706034 5 Left 921706023 1:218323710-218323732 CCCACCTCGGCCTCCCTCTCATG 0: 1
1: 4
2: 23
3: 139
4: 885
Right 921706034 1:218323738-218323760 TGGCACCCAAAGTCCGGAGGGGG 0: 2
1: 35
2: 74
3: 137
4: 254
921706023_921706045 25 Left 921706023 1:218323710-218323732 CCCACCTCGGCCTCCCTCTCATG 0: 1
1: 4
2: 23
3: 139
4: 885
Right 921706045 1:218323758-218323780 GGGCCAAGGGGGCAGGGGCCTGG 0: 1
1: 2
2: 52
3: 256
4: 1375
921706023_921706040 14 Left 921706023 1:218323710-218323732 CCCACCTCGGCCTCCCTCTCATG 0: 1
1: 4
2: 23
3: 139
4: 885
Right 921706040 1:218323747-218323769 AAGTCCGGAGGGGGCCAAGGGGG 0: 3
1: 37
2: 93
3: 147
4: 276
921706023_921706044 20 Left 921706023 1:218323710-218323732 CCCACCTCGGCCTCCCTCTCATG 0: 1
1: 4
2: 23
3: 139
4: 885
Right 921706044 1:218323753-218323775 GGAGGGGGCCAAGGGGGCAGGGG 0: 1
1: 13
2: 99
3: 250
4: 1357
921706023_921706043 19 Left 921706023 1:218323710-218323732 CCCACCTCGGCCTCCCTCTCATG 0: 1
1: 4
2: 23
3: 139
4: 885
Right 921706043 1:218323752-218323774 CGGAGGGGGCCAAGGGGGCAGGG 0: 1
1: 3
2: 42
3: 172
4: 612
921706023_921706038 12 Left 921706023 1:218323710-218323732 CCCACCTCGGCCTCCCTCTCATG 0: 1
1: 4
2: 23
3: 139
4: 885
Right 921706038 1:218323745-218323767 CAAAGTCCGGAGGGGGCCAAGGG 0: 1
1: 0
2: 5
3: 21
4: 108
921706023_921706037 11 Left 921706023 1:218323710-218323732 CCCACCTCGGCCTCCCTCTCATG 0: 1
1: 4
2: 23
3: 139
4: 885
Right 921706037 1:218323744-218323766 CCAAAGTCCGGAGGGGGCCAAGG 0: 4
1: 71
2: 157
3: 218
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921706023 Original CRISPR CATGAGAGGGAGGCCGAGGT GGG (reversed) Intronic
900049686 1:586549-586571 CATGCGAGGGAGGTAGAGGCAGG - Intergenic
900211297 1:1457101-1457123 GACGAGAGGGAGGCCAAGCTGGG - Intronic
900268150 1:1770798-1770820 CAACACTGGGAGGCCGAGGTGGG + Intronic
900326003 1:2108992-2109014 CGTGAGACGGAGGCAGAGGCTGG - Intronic
900461323 1:2803338-2803360 CCGGACAGGGAGGCCGAGGCCGG + Intergenic
900611550 1:3546611-3546633 GGTGCCAGGGAGGCCGAGGTGGG + Intronic
900611568 1:3546656-3546678 GCTGCCAGGGAGGCCGAGGTGGG + Intronic
900611621 1:3546797-3546819 GCTGCCAGGGAGGCCGAGGTGGG + Intronic
901041725 1:6368278-6368300 CATGGGAGGGAGGCCAAGTGGGG - Intronic
901123382 1:6912699-6912721 GCTGAGAGGGAGGCAGAGGTGGG - Intronic
901251480 1:7783630-7783652 CATTAGAGGGAGGGAGAGGCGGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901408268 1:9064806-9064828 CTTTGGTGGGAGGCCGAGGTGGG + Intronic
901568809 1:10142422-10142444 CAACACTGGGAGGCCGAGGTGGG + Intronic
901597060 1:10393658-10393680 AAATATAGGGAGGCCGAGGTGGG - Intergenic
901611865 1:10505030-10505052 TTTGGGAGGGAGGCCAAGGTGGG - Intronic
901974034 1:12930252-12930274 CATGGGAGGGAGGCTGAGAGGGG + Intronic
902011146 1:13271516-13271538 CATGGGAGGGAGGCTGAGAGGGG - Intergenic
902294733 1:15459272-15459294 GCTGATAGGGAGGCTGAGGTGGG - Intronic
902339330 1:15772455-15772477 CATGAGAGGGAGGGGGGAGTGGG + Intronic
902866966 1:19286036-19286058 CAGGAAAGGGAGGCCAGGGTGGG + Intronic
902958035 1:19940127-19940149 CACGCCTGGGAGGCCGAGGTGGG - Intergenic
902958299 1:19942248-19942270 CAGTTGAGGGATGCCGAGGTTGG + Intergenic
903009550 1:20320081-20320103 CATGAGCGGGAGGCAGAGCATGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903832537 1:26183610-26183632 CATGAGTGGGAGGCAGAAGTGGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904059691 1:27698888-27698910 CATGGTTGGGAGGCCGAGGTGGG + Intergenic
904090291 1:27940356-27940378 CATGAGAGACAGGACAAGGTGGG - Intronic
904265433 1:29315968-29315990 GATGAGAATGAGGCCGAGGAGGG - Intronic
904299928 1:29547647-29547669 CCTAAGATGAAGGCCGAGGTTGG + Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905244896 1:36605932-36605954 CAGGAGAGGGAGGCAGAGATGGG + Intergenic
905491116 1:38344544-38344566 CATAGGAGGGAGGCTGAAGTAGG + Intergenic
906121060 1:43391066-43391088 CAACACTGGGAGGCCGAGGTGGG + Intronic
906421799 1:45675050-45675072 CTTCATTGGGAGGCCGAGGTGGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906625886 1:47325260-47325282 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
906626646 1:47331413-47331435 CAGGAGGTGGAGGCTGAGGTGGG - Intergenic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906959355 1:50407230-50407252 TTTGGGAGGGAGGCCGAGGAGGG + Intergenic
907014006 1:50993404-50993426 GAAAAGAGGGAGGCCGAAGTGGG + Intergenic
907548439 1:55283674-55283696 CATGAGAGAGAGAGAGAGGTAGG - Intergenic
907650143 1:56287063-56287085 GGTGAGAGGAAGGCCTAGGTTGG - Intergenic
907858714 1:58328848-58328870 CAGGATTGGGAGGCCGAGGCAGG - Intronic
908076567 1:60525979-60526001 CAAAACTGGGAGGCCGAGGTGGG + Intergenic
908302591 1:62776965-62776987 CAAAATTGGGAGGCCGAGGTGGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910200843 1:84697113-84697135 CATGCCAGGGAGGGCTAGGTGGG - Intergenic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
910733763 1:90428667-90428689 TTTGAGAGGGAGGCAGAGGGAGG + Intergenic
911025908 1:93435277-93435299 CATGGGAGGGAGGCTGAGAGGGG - Intergenic
912013791 1:105005796-105005818 CATGGGAGGGAGCCTCAGGTGGG - Intergenic
912332489 1:108832329-108832351 CTTGGAAGGGAGGCTGAGGTGGG - Intronic
912527629 1:110295817-110295839 CATTAGTGGGAGGCTGAGGCAGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912927071 1:113922621-113922643 CAGGACTGGGAGGCCGAGGTAGG - Intergenic
912927096 1:113922826-113922848 CTTGAGAGGGAGGCTGAGGTTGG - Intergenic
913459613 1:119070371-119070393 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
913614825 1:120547771-120547793 TACGTGAGGGAGGCCGAGGTGGG + Intergenic
914575446 1:148963136-148963158 TACGTGAGGGAGGCCAAGGTGGG - Intronic
914741966 1:150472755-150472777 CAGGAGGGGGAGGAGGAGGTGGG - Exonic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914952439 1:152128550-152128572 CATAAGATGGAGGCAGAGATTGG + Intergenic
915189524 1:154137174-154137196 TTTGGGAGGGAGGCCAAGGTGGG + Intronic
915388321 1:155517519-155517541 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
915452734 1:156017992-156018014 CATTTTTGGGAGGCCGAGGTGGG - Intronic
915474233 1:156143589-156143611 TAAGAGAGGGAGGCTGAGGTGGG + Intergenic
915555741 1:156659834-156659856 CCAGAGAGGAAGGCAGAGGTTGG + Intergenic
915637383 1:157196036-157196058 CAGGGGAGGGAGGCTGAGATGGG + Intergenic
915778518 1:158518705-158518727 CTTGACAGGGAGGTCGAGGCGGG - Intergenic
917009164 1:170451535-170451557 CATTAGTGGGAGGCTGAGGAAGG + Intergenic
917101001 1:171445258-171445280 TATCAGACGGAGGCCGAGGCAGG + Intergenic
917341726 1:173986524-173986546 GGAGAGAGGGAGGCCAAGGTGGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
917421535 1:174868798-174868820 CTTGATAGGGAGGCCTGGGTGGG - Intronic
917848860 1:179043150-179043172 CATGGGAGGGAGGCCAAGGGAGG - Intronic
918590907 1:186240194-186240216 CTTGGGAGAGAGGCTGAGGTGGG - Intergenic
918642836 1:186864006-186864028 TTTGGGAGGGAGGCCGAGGAAGG - Intronic
919420630 1:197365737-197365759 CAAGAGAAGGTGGCCGAGGTTGG - Intronic
919629615 1:199947444-199947466 TTTGGGAGGGAGGCCGAGGCAGG + Intergenic
919735590 1:200948249-200948271 CAGAAGAGGGGGGCCGGGGTGGG + Intergenic
920165842 1:204035327-204035349 TTTGGGAGGGAGGCCGAGGCGGG - Intergenic
921097759 1:211901725-211901747 CATGGGAGGGAAGCCTAGGTGGG + Intergenic
921427531 1:215021792-215021814 CAGGCGTGGGAGGCCGAGGCGGG - Intronic
921498506 1:215870539-215870561 CAGCAGTGGGAGGCCGAGGTGGG - Intronic
921706023 1:218323710-218323732 CATGAGAGGGAGGCCGAGGTGGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922476154 1:225908185-225908207 TTTGGGAGGGAGGCCAAGGTGGG - Intronic
922504442 1:226118512-226118534 CATGAGCAGCAGGCCAAGGTGGG - Intergenic
923049227 1:230379064-230379086 CATGTGAGTGAGGCCATGGTTGG - Intronic
923385980 1:233465687-233465709 CATGAATGGGAGACTGAGGTGGG + Intergenic
923479744 1:234373104-234373126 CCTGGGAGGCAGGCTGAGGTGGG + Intergenic
923587669 1:235289475-235289497 CAACACTGGGAGGCCGAGGTAGG + Intronic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
923818227 1:237404140-237404162 CATAATCGGGAGGCTGAGGTGGG + Intronic
924228636 1:241944466-241944488 CATCTTTGGGAGGCCGAGGTGGG + Intergenic
924693390 1:246374724-246374746 CAGGAGTGTGAGGCCGAGGTTGG + Intronic
924704952 1:246493216-246493238 GAGGAGAGGGGGGCTGAGGTAGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063395684 10:5685114-5685136 CATGGGAAGGAGGCCGAGCCGGG + Exonic
1063449590 10:6142604-6142626 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1063466465 10:6248380-6248402 TTTGGGAGGGAGGCCGAGGTGGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064812093 10:19211444-19211466 CAAGACTGGGAGGCCGAGGCGGG + Intronic
1065286623 10:24193163-24193185 CAGGAGGGGGAGGCCGAGGTGGG - Intronic
1065545943 10:26820830-26820852 TATTATTGGGAGGCCGAGGTGGG - Intronic
1065600131 10:27359458-27359480 CCTGAGAGGGAGGCCAAGGCGGG + Intergenic
1065976515 10:30847005-30847027 CATGGAAGGGAGGCTGAGGAAGG + Intronic
1065998968 10:31086478-31086500 AATGTTTGGGAGGCCGAGGTGGG + Intergenic
1066364342 10:34762403-34762425 GATGGGAGGAAGGCTGAGGTGGG - Intronic
1066581886 10:36890436-36890458 CCTGGGAGGGAGGCTGAGATGGG - Intergenic
1067129552 10:43549835-43549857 GATGAAAAGAAGGCCGAGGTAGG - Intergenic
1068213518 10:53952761-53952783 CATGGGAGAGAAGCCAAGGTGGG - Intronic
1068443846 10:57095272-57095294 CACAGGAGGGAAGCCGAGGTGGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069049476 10:63777509-63777531 CATTTAAGGGAGGCTGAGGTAGG + Intergenic
1069378978 10:67822739-67822761 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1069561824 10:69436051-69436073 CCTGGGAGGGAGGCTGAGGTGGG - Intergenic
1069741622 10:70688829-70688851 CATGAGAGGGAGACCGGAGGGGG + Intronic
1069760589 10:70808389-70808411 CATGACTGGGAGGCTGAGGCGGG + Intergenic
1069768842 10:70884726-70884748 CATATTTGGGAGGCCGAGGTGGG - Intronic
1069927276 10:71859554-71859576 CATGGGATGGAGGGCAAGGTCGG - Intergenic
1070083841 10:73215265-73215287 TTTGGGAGGGAGGCCAAGGTGGG - Intronic
1070201227 10:74207951-74207973 CATGGGAAGGAGGCCAAGGTGGG - Intronic
1070779115 10:79127299-79127321 CATGAGAGAGAGGCCGCTGCAGG - Intronic
1070811800 10:79301809-79301831 CATGATGGGGAGGCAGTGGTAGG + Intronic
1071052902 10:81473256-81473278 CATGGGACGGAGGCCAAGGAGGG + Intergenic
1071440863 10:85692553-85692575 CACAGGAGGGAGGCTGAGGTGGG + Intronic
1071533224 10:86404976-86404998 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1071959466 10:90796118-90796140 CATGATAGGAAGGGGGAGGTTGG - Intronic
1072219359 10:93314800-93314822 CAATATTGGGAGGCCGAGGTGGG + Intronic
1072464695 10:95652487-95652509 TTTGGGAGGGAGGCCGAGGCGGG + Intronic
1072464912 10:95654407-95654429 CAATATTGGGAGGCCGAGGTGGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072894942 10:99358761-99358783 CAAGAGTGGCAGGCAGAGGTGGG - Intronic
1072973112 10:100034481-100034503 TACCAGAGGGAGGCCGAGGGGGG + Intergenic
1073891101 10:108102830-108102852 GATACTAGGGAGGCCGAGGTAGG + Intergenic
1074203403 10:111259510-111259532 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1074425704 10:113349363-113349385 CTATAAAGGGAGGCCGAGGTGGG + Intergenic
1074490389 10:113934579-113934601 CATGTGTGGGAGGCCAAGGCGGG + Intergenic
1074908438 10:117885293-117885315 CAGGAGAGGGAGGCTGCTGTGGG - Intergenic
1075237437 10:120743746-120743768 CATGATAAGGAGGCAGAGGCTGG + Intergenic
1075370710 10:121932609-121932631 CAGGATTGGGAGGCCGAGGTGGG - Intergenic
1075582619 10:123633793-123633815 CAGGAGAGGAAGGCAGAGGAGGG + Intergenic
1075844263 10:125532532-125532554 CAACACTGGGAGGCCGAGGTAGG - Intergenic
1076018464 10:127049272-127049294 TTTGGGAGGGAGGCCTAGGTGGG + Intronic
1076257293 10:129037779-129037801 CAAGAGTTGGAGGCCGAGGCAGG - Intergenic
1077061840 11:620986-621008 CAGGAGAGGAAGGGCGGGGTCGG - Intronic
1077065096 11:637540-637562 CAGGAGAGCGAGGAGGAGGTCGG - Exonic
1077351530 11:2095306-2095328 CTGGAGAGGGAGGTTGAGGTGGG - Intergenic
1077493358 11:2872437-2872459 CTCGAGAGGGAGGCTGAGGCAGG - Intergenic
1077558054 11:3236079-3236101 CAAGAGAGGGAGGCTGAGGTGGG + Intergenic
1077734917 11:4781299-4781321 GATTGCAGGGAGGCCGAGGTGGG + Intronic
1077938805 11:6818192-6818214 CATGGGAGGGGGACTGAGGTAGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078216717 11:9318007-9318029 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1078592434 11:12655372-12655394 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1078601629 11:12737143-12737165 GAGGAGACGGAGGCCTAGGTAGG + Intronic
1079750685 11:24192325-24192347 CATGAGAGGGACTCCGTGGGAGG - Intergenic
1079877285 11:25875762-25875784 TACGAGAGGGAGGGAGAGGTTGG + Intergenic
1080800640 11:35606939-35606961 CAGGAGTGAGAGGCCAAGGTGGG + Intergenic
1081368781 11:42272193-42272215 CATTTGTGGTAGGCCGAGGTGGG - Intergenic
1081626003 11:44655530-44655552 CATGCCTAGGAGGCCGAGGTGGG - Intergenic
1081767439 11:45621411-45621433 CATGGGAGGGAGGCTGAGGTGGG - Intergenic
1082687748 11:56260614-56260636 CATGGGAGGGAGGCTGTGGGGGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083041513 11:59691948-59691970 CAGGATGGGGAGGCTGAGGTGGG - Intergenic
1083171955 11:60928507-60928529 CATGAAAGGGAGGCCCAGCATGG - Intronic
1083711122 11:64549204-64549226 GATGAAAGGGAGGCCGAGGCGGG - Intergenic
1083784945 11:64939207-64939229 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1083806684 11:65078680-65078702 CAGGAGGGAGAGGCCGAGGCTGG + Exonic
1083850378 11:65362568-65362590 CAAGTGAGGGAGGCCAAGGAGGG + Intergenic
1083916031 11:65744300-65744322 CATGGGAGGGAGGCCAAGGCGGG + Intergenic
1084275718 11:68050049-68050071 GATGAAGAGGAGGCCGAGGTGGG + Exonic
1085422006 11:76370708-76370730 TATGACCGGGAGGCTGAGGTAGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085496827 11:76978041-76978063 CATGGGAGGGAGGCCGAGGCGGG + Intronic
1085633613 11:78140435-78140457 CAACACTGGGAGGCCGAGGTGGG + Intergenic
1086782565 11:90926271-90926293 CATGTTTAGGAGGCCGAGGTGGG + Intergenic
1086993613 11:93331798-93331820 CAAGTTTGGGAGGCCGAGGTGGG + Intronic
1087093756 11:94300716-94300738 CTCGGGAGGGAGGCTGAGGTGGG + Intergenic
1087124114 11:94606486-94606508 GATGAGAAGGAGGCGGAGGTAGG + Intronic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087605599 11:100373767-100373789 CAAGAGAGAGAGGTCAAGGTTGG - Intergenic
1088735818 11:112726949-112726971 GATGCGAGGGAGGCTGAGGAAGG - Intergenic
1089798637 11:121004942-121004964 CCTGGGAGGGAAGCTGAGGTGGG - Intergenic
1089855988 11:121545193-121545215 CATTAGAGGCAGGCCCATGTAGG - Intronic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090938385 11:131365664-131365686 CATGAGGAGGAGGAGGAGGTGGG - Intergenic
1091370401 11:135052658-135052680 AAAGAGAGAGAGACCGAGGTGGG - Intergenic
1092167840 12:6353982-6354004 AGAGAGAGGGAGGCCGAGGCGGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092824171 12:12382272-12382294 TAAGAGAGGGAGACAGAGGTGGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092885629 12:12922372-12922394 AATTAGAGGGAGGCAGAGGAAGG + Intergenic
1093464912 12:19439645-19439667 CGAGAGAGGGAGGCGGCGGTGGG + Intronic
1093493052 12:19726261-19726283 CATAGGAGGGAAGCCGAGGTGGG - Intergenic
1093525766 12:20102304-20102326 CATGGGAGGGAGGCCAAGCTGGG - Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094134148 12:27106315-27106337 CATGTGAGGGAGGTCAAGGTTGG + Intergenic
1095337467 12:41046187-41046209 CATGAGTGGGTGGCTGAGGCAGG - Intronic
1095441148 12:42239357-42239379 TGGGAGAGGGAGGCAGAGGTAGG - Intronic
1095444132 12:42267801-42267823 CACGGGAGGGAGGCCAAGGGGGG - Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096058663 12:48677671-48677693 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1096330449 12:50707809-50707831 CATGGGAGGGAGGATGAAGTTGG - Intronic
1096550869 12:52370815-52370837 CCTGAGAGTGGGGCTGAGGTGGG - Intergenic
1096993312 12:55822368-55822390 CACCAGAGGGCGGCAGAGGTAGG - Exonic
1097459508 12:59843390-59843412 GATTAGAGGGTGGCAGAGGTAGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098790528 12:74816740-74816762 CATGGGAGGGAGGCTGAGGTGGG + Intergenic
1098822669 12:75252620-75252642 CAGGAGTGGGAGGCCGAGGCAGG + Intergenic
1098984217 12:76993126-76993148 TTTGGGAGGGAGGCCAAGGTGGG - Intergenic
1099427470 12:82541161-82541183 AATGATTGGGAGGCCGAGGCGGG - Intergenic
1099463718 12:82956559-82956581 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1099910952 12:88832770-88832792 CATGAGAGAGAGGTGGAGGTGGG + Intergenic
1100820397 12:98423965-98423987 CATGACAGAGAGGCTGAGGCAGG + Intergenic
1100990856 12:100250062-100250084 CATTTCAGGGAGGCTGAGGTGGG - Intronic
1101016645 12:100508031-100508053 GAACAGAGGGAGGCCCAGGTAGG + Intronic
1102039812 12:109793682-109793704 GAAGAGAGGGAGGCAGAGGCTGG + Intronic
1102531145 12:113547424-113547446 TAGGAGAGGGAGGCAGAGGGAGG + Intergenic
1102836124 12:116062398-116062420 CAATAGAGGGAGGTTGAGGTGGG - Intronic
1103293243 12:119864580-119864602 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1103348309 12:120265591-120265613 AGTGAGCGGGAGGCCGAGGGAGG - Intronic
1103477259 12:121227837-121227859 CAGCACAGGGAGGCGGAGGTAGG + Intronic
1103637141 12:122316454-122316476 CATCACTGGGAGGCTGAGGTGGG - Intronic
1103703864 12:122861175-122861197 CAGGAGATGGAGACCCAGGTAGG + Exonic
1103863520 12:124032998-124033020 CATGTTTGGGAGGCTGAGGTGGG - Intronic
1104466477 12:128994646-128994668 CAACACTGGGAGGCCGAGGTGGG - Intergenic
1104643984 12:130484257-130484279 CATGAGAGGCAGGCAGATGGTGG - Intronic
1104742480 12:131188630-131188652 CATGGGAGGGAGGCTGAGGGGGG + Intergenic
1105235173 13:18544575-18544597 AATGTTTGGGAGGCCGAGGTGGG - Intergenic
1105424837 13:20285229-20285251 TAAGAGAGGGGGGCCTAGGTTGG - Intergenic
1105867384 13:24473166-24473188 GTTGGGAGGGAGGCTGAGGTAGG - Intronic
1106207890 13:27616448-27616470 CATGAGTGGGAAGTGGAGGTCGG - Intronic
1106216500 13:27706585-27706607 CATAAGAGGGAGGCAGAGCCAGG - Intergenic
1106265458 13:28105579-28105601 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1106290919 13:28361031-28361053 CACTTGTGGGAGGCCGAGGTGGG + Intronic
1106531063 13:30591746-30591768 CATGCGTGGTAGGCCAAGGTGGG - Intronic
1106710595 13:32327423-32327445 GGTGACAGGGAGGCTGAGGTGGG + Intronic
1107001372 13:35549588-35549610 TATGAGAGGAAGGCCAAGGTTGG - Intronic
1107475722 13:40733846-40733868 CCTGTATGGGAGGCCGAGGTGGG + Intronic
1108287623 13:48924458-48924480 CTCGGGAGGGAGGCTGAGGTGGG - Intergenic
1108526341 13:51288676-51288698 GATGAGAGAGAAGGCGAGGTGGG - Intergenic
1108536247 13:51382967-51382989 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1108737198 13:53296733-53296755 TTTGGGAGGGAGGCCAAGGTGGG - Intergenic
1108844396 13:54660145-54660167 CATGTGAGGGAGACTGAGGGAGG - Intergenic
1108868596 13:54952963-54952985 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1109516978 13:63456423-63456445 CACGCCTGGGAGGCCGAGGTAGG - Intergenic
1109687748 13:65843643-65843665 CATGGAAGGGAGACAGAGGTTGG + Intergenic
1109762249 13:66845254-66845276 CATGGGAGGGAGGCTGAAGTGGG - Intronic
1109982256 13:69924116-69924138 CATGGGAGGGAGGCCAAGGAGGG + Intronic
1110342892 13:74413708-74413730 CATGGGAGGGAGGCTGAGGCAGG + Intergenic
1110777953 13:79432320-79432342 CATGGGAGGGAGGCCAAGGAGGG + Intergenic
1111237760 13:85431217-85431239 CATGGGAGAGAGGCCACGGTGGG + Intergenic
1111253626 13:85638867-85638889 CATGGGAGGGAGGCTGAAGGGGG - Intergenic
1111360408 13:87168295-87168317 CACGGGAGGGAGGGTGAGGTGGG - Intergenic
1111485658 13:88895707-88895729 CATGGGAGGGAGGCCAAGGCAGG + Intergenic
1112279846 13:98053347-98053369 CTTGGGAGGCAGGCTGAGGTGGG - Intergenic
1112401935 13:99085826-99085848 AAGGAGAGGGAGGCCGGGGGAGG + Intronic
1112650664 13:101393568-101393590 CATAAGTGGGAGGCCGAGGCGGG + Intronic
1113807702 13:113119109-113119131 CATGGGAGGGAGGGAGAGGTGGG + Exonic
1114082840 14:19216425-19216447 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114534891 14:23416596-23416618 AAACAGAGGGAGGCAGAGGTGGG + Intronic
1115187822 14:30711484-30711506 CATGCTTGGGAGGCTGAGGTGGG + Intronic
1115622310 14:35152611-35152633 TCTGGGAGGGAGGCGGAGGTGGG - Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1116902214 14:50372010-50372032 CATAGGAGGGAGGCCAAGGGAGG + Intronic
1117269744 14:54130935-54130957 AATGAGTGGGAGGCTGAGGTAGG - Intergenic
1117850676 14:59965635-59965657 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1118200141 14:63663820-63663842 CATGGGAGGGAGGCTGAGTGGGG - Intergenic
1118308414 14:64675125-64675147 CAGGTTTGGGAGGCCGAGGTGGG + Intergenic
1118995207 14:70829486-70829508 CATTTTTGGGAGGCCGAGGTGGG + Intergenic
1119045329 14:71314037-71314059 CATTAGCTGGAGGCTGAGGTGGG - Intergenic
1119257229 14:73208932-73208954 CATGGGAGGGAGACTGAGGAGGG - Intronic
1119297514 14:73545168-73545190 GCTGCTAGGGAGGCCGAGGTGGG - Intronic
1119301743 14:73577040-73577062 GCTGCTAGGGAGGCCGAGGTGGG - Intergenic
1119318942 14:73718215-73718237 CTTGGGAGGGAGGCCGCGGCAGG - Exonic
1119377820 14:74208886-74208908 CATGGGAGGGAGCACGTGGTGGG + Intergenic
1119414417 14:74460030-74460052 GATGAGAGGGAGGAAGAGCTGGG - Intergenic
1119835076 14:77742141-77742163 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1120339830 14:83204911-83204933 CATGTTAGGGAGGCTGAGGCAGG - Intergenic
1120885780 14:89450829-89450851 GAGCAAAGGGAGGCCGAGGTGGG - Intronic
1121038270 14:90724564-90724586 CAAGAGAGTGAGGGCGAGGCAGG - Intronic
1121394302 14:93605788-93605810 AAAGAGAGGGAGTCCGAAGTGGG + Intronic
1121549628 14:94789051-94789073 CTTGGGAGGGAGGCTGAGGCAGG - Intergenic
1121777017 14:96597955-96597977 AAAGAGAAGGAGGCAGAGGTGGG - Intergenic
1121871065 14:97407950-97407972 AATCAGAGGGAGGCAGAGGTGGG - Intergenic
1121940398 14:98064755-98064777 CCCAAGAGGGAGCCCGAGGTGGG - Intergenic
1122460250 14:101888701-101888723 CATATGTGGGAGGCTGAGGTGGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122622093 14:103064987-103065009 CATGCTTGGGAGGCCGAGGTGGG - Intergenic
1122956633 14:105074404-105074426 CAGCAGTGGGAGGCCAAGGTTGG + Intergenic
1202909593 14_GL000194v1_random:104625-104647 CACAGGAGGGAGGCTGAGGTGGG + Intergenic
1123996362 15:25720613-25720635 GAGGAGAGGGAGGCCGAAGGAGG + Intronic
1124082859 15:26517463-26517485 CCTGATTGGGAGGCTGAGGTGGG - Intergenic
1124111316 15:26791749-26791771 GAGGTGAGGGAGGCTGAGGTGGG - Intronic
1124231859 15:27952788-27952810 CTGGGGAGGGAGGCTGAGGTAGG - Intronic
1124820806 15:33044166-33044188 CATGGGATGGAGGCTGAGGAGGG + Intronic
1125669148 15:41457285-41457307 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1125702495 15:41699744-41699766 CATAATTGGGAGGCCGAGGCGGG - Intronic
1125718061 15:41830860-41830882 CATGGGAGGGAGGCCAAGAGGGG + Intronic
1125799112 15:42429009-42429031 CATGTAAGGGAGGCCGAGGCGGG - Intronic
1125849272 15:42887900-42887922 CATGAGAATTATGCCGAGGTAGG - Intronic
1126004768 15:44245662-44245684 AATGTTTGGGAGGCCGAGGTGGG - Intergenic
1126215172 15:46146219-46146241 CATGGCAGGGAGGTTGAGGTGGG + Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126890660 15:53200851-53200873 CAGGAGAGGGAGGGGAAGGTTGG + Intergenic
1126990891 15:54374386-54374408 CATGAGAGGGAGGCCGGGGTGGG - Intronic
1127201333 15:56655451-56655473 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1127305372 15:57700476-57700498 CGTGGGAGGGAGGCTGAGGTGGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127865851 15:63032084-63032106 CATGACAGGGAGCCCAGGGTGGG - Intergenic
1128057687 15:64712854-64712876 CTTGGGAGGGAGGCTGAGGCAGG - Intergenic
1128326366 15:66726486-66726508 ACTGAGAGGGAAGCCGAGGAGGG + Intronic
1128451442 15:67807985-67808007 CATGAGATGGAAGCCCAGCTGGG - Intergenic
1128466585 15:67917816-67917838 CATGGGCGGGATGCAGAGGTGGG + Intergenic
1129454796 15:75670873-75670895 CAAGAGAGGGAAGCAGAGGAGGG - Intergenic
1129626221 15:77202788-77202810 CATCTTTGGGAGGCCGAGGTGGG + Intronic
1129818389 15:78576685-78576707 GATAGGAGGGAGGCTGAGGTGGG + Intronic
1130111850 15:80971836-80971858 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1130949521 15:88574415-88574437 CATGAGAGGGAAGCAAACGTGGG - Intergenic
1131300475 15:91195267-91195289 CATAATCGGGAGGCTGAGGTGGG - Intronic
1131333092 15:91520718-91520740 CATGATTGGGAGGCTGAGGTGGG - Intergenic
1131483628 15:92802586-92802608 CCTAAGAGGGAGGCAGAGGAAGG - Intronic
1131562303 15:93455154-93455176 GAGGAGAGGGAGGCGGAGGGAGG + Intergenic
1132202741 15:99966036-99966058 CAATTGAGGGAGGCCGAGGCGGG - Intergenic
1132307856 15:100830630-100830652 CACGAGAAGGAAGCCGAGGCAGG + Intergenic
1132534188 16:469181-469203 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1132850138 16:2021267-2021289 TTTGGGAGGGAGGCTGAGGTGGG - Intergenic
1133132981 16:3689488-3689510 AATGTGTGGGAGGCCGAGGCGGG - Intronic
1133191861 16:4139709-4139731 GGTGCTAGGGAGGCCGAGGTGGG + Intergenic
1133471100 16:6076577-6076599 CAAGACTGGGAGGCAGAGGTGGG - Intronic
1133490670 16:6264986-6265008 CATGGGAGGCAGGACGAGGTTGG - Intronic
1134015854 16:10887783-10887805 CATGAGAAGGAGGCCAGGGGTGG - Intronic
1134079898 16:11317504-11317526 TATGATTGGGAGGCCGAGGCGGG - Intronic
1134171869 16:11975835-11975857 CATGATTGGGAGGCCAAGGTGGG - Intronic
1134408784 16:13985778-13985800 AATGTGTGGGAGGCCAAGGTGGG - Intergenic
1134470577 16:14521688-14521710 CACGGGAGGGAGGCTGAGGCAGG + Intronic
1134490829 16:14694227-14694249 CATCGGAGGGTGGCAGAGGTGGG + Exonic
1134496210 16:14733345-14733367 CATCGGAGGGTGGCAGAGGTGGG + Intronic
1134506025 16:14807645-14807667 CATGATTGGGAGGCCGGGGCAGG + Intronic
1134518321 16:14904946-14904968 CTTGAATGGGAGGCCGAGGAGGG - Intronic
1134555608 16:15161277-15161299 CTTGAATGGGAGGCCGAGGAGGG + Intergenic
1134705992 16:16303601-16303623 CTTGAATGGGAGGCCGAGGAGGG - Intergenic
1134939548 16:18276654-18276676 CATGATTGGGAGGCCGGGGCAGG - Intergenic
1134961548 16:18408509-18408531 CTTGAATGGGAGGCCGAGGAGGG + Intergenic
1134965848 16:18491112-18491134 CTTGAATGGGAGGCCGAGGAGGG + Intronic
1135079389 16:19421326-19421348 CATGAGAGGGACGCTGTGGGAGG + Intronic
1135188945 16:20338736-20338758 CATAGCAGGGAGGCCGAGGCAGG - Intronic
1135273352 16:21087649-21087671 TATGAGAGGGAGGCTGAGGCAGG + Intronic
1136154591 16:28374485-28374507 CATCGGAGGGTGGCAGAGGTGGG - Intergenic
1136208500 16:28740779-28740801 CATCGGAGGGTGGCAGAGGTGGG + Intergenic
1136264584 16:29107443-29107465 CATCGGAGGGTGGCAGAGGTGGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137524769 16:49225047-49225069 CATGAGAGGGACCCGGAGGGAGG - Intergenic
1137658464 16:50182018-50182040 CTTTAGTAGGAGGCCGAGGTGGG + Intronic
1137792442 16:51186362-51186384 TTTGGGAGGGAGGCCAAGGTGGG - Intergenic
1138175835 16:54897493-54897515 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1138925145 16:61581562-61581584 CATGGGAAGGAGGTCGAGGCGGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139621243 16:68145052-68145074 CACGGCAGGGAGGCCAAGGTGGG - Intronic
1139625874 16:68188008-68188030 CATGGGAGGGAGGTCGAGGTAGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139899958 16:70320480-70320502 CTTGGGTGGGAGGCCGAGGTGGG - Intronic
1140218420 16:73026259-73026281 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1140294878 16:73699127-73699149 CTTGATTGGGAGGCCAAGGTGGG - Intergenic
1140422644 16:74833322-74833344 AAAATGAGGGAGGCCGAGGTGGG - Intergenic
1140665315 16:77222138-77222160 TATCATTGGGAGGCCGAGGTGGG - Intergenic
1140885028 16:79235452-79235474 CACTGGAGGGAGGCTGAGGTGGG + Intergenic
1141000490 16:80302932-80302954 CATGAGAGGGACCCCGTGGGAGG + Intergenic
1141558067 16:84849158-84849180 GGAGGGAGGGAGGCCGAGGTGGG - Intronic
1141569714 16:84927200-84927222 TTTGAGAGGGAGGCCGAGGCAGG + Intergenic
1141844542 16:86598378-86598400 AATGAGAGAGAGAGCGAGGTTGG - Intergenic
1141978245 16:87532578-87532600 CTGAAGAGGGAGGCCAAGGTGGG - Intergenic
1142377700 16:89714977-89714999 AATGGGAGGGAGGCCAAGGCAGG - Intronic
1142493447 17:293243-293265 CATGAGTGGCAGGCGGAGGGAGG - Intronic
1142527856 17:557253-557275 CGTGAGAAGGAGGCAGAGGCTGG - Intronic
1142599453 17:1046513-1046535 AAAGAGCAGGAGGCCGAGGTGGG - Intronic
1142610293 17:1105752-1105774 AGTGAGGGGGAGGCTGAGGTGGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142983264 17:3683482-3683504 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1143110508 17:4550213-4550235 CGTGACAGGGAGGCCTTGGTTGG + Exonic
1143167786 17:4906604-4906626 CATCACTGGGAGGCTGAGGTAGG + Intergenic
1143590385 17:7882822-7882844 CCTGAGAGGGAGGGGTAGGTGGG - Intronic
1143977934 17:10844116-10844138 CATGGGAAGGAGTCCGGGGTGGG + Intergenic
1144197461 17:12908441-12908463 CATGAGGCAGAGGCCGAGGCGGG - Intronic
1145109306 17:20147928-20147950 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1145220381 17:21083758-21083780 GAACATAGGGAGGCCGAGGTGGG - Intergenic
1145983860 17:29031202-29031224 CTTTAGGGGGAGGCCGAGATGGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146334943 17:31961298-31961320 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1146359119 17:32159733-32159755 CATGGGAGGGAGGCTGAGATGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146589950 17:34120316-34120338 CACCAGAGAGAGGCAGAGGTGGG - Intronic
1147007582 17:37416364-37416386 ATTGAGAGGGAGGCCGAGGCAGG - Intronic
1147057903 17:37848261-37848283 TGTGATTGGGAGGCCGAGGTGGG + Intergenic
1147319831 17:39639492-39639514 TATCAGAGGGAGGCAGAGGCTGG + Intronic
1147377915 17:40033735-40033757 CAGGAGAGAGAGGCAGAGGGAGG + Intronic
1147412716 17:40265071-40265093 AAAGATGGGGAGGCCGAGGTGGG - Exonic
1147623308 17:41882767-41882789 GATGAAAGGGAGGCCAAGGAGGG - Intronic
1147782988 17:42957070-42957092 ACTGGGAGGGAGGCGGAGGTGGG - Intronic
1147947491 17:44088257-44088279 CCTGATTGGGAGGCCGAGGTGGG - Intronic
1148051239 17:44770866-44770888 CATCACTGGGAGGCTGAGGTGGG + Intronic
1148085590 17:44991945-44991967 CAGGAGAGGGGGGCTGAGATGGG + Intergenic
1148104763 17:45113292-45113314 CATGAGGGGATGGCCAAGGTGGG - Intronic
1148321453 17:46757745-46757767 TCCGAGAGGGAGGCTGAGGTGGG + Intergenic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1149256896 17:54837016-54837038 CATGGGAGGGAAGCTGAGGTGGG - Intergenic
1149292574 17:55231737-55231759 CATGAAAGGGAGTCCGGGGATGG - Intergenic
1149484178 17:57029046-57029068 CCTGATTGGGAGGCCGAGGTGGG - Intergenic
1149827651 17:59844192-59844214 CTTGCCAGGGAGGCTGAGGTAGG - Intergenic
1150030741 17:61732227-61732249 CATCACTTGGAGGCCGAGGTGGG - Intronic
1150483045 17:65525175-65525197 CAGGATTGAGAGGCCGAGGTGGG + Intergenic
1150521000 17:65866346-65866368 CATGGGAGGGAGGCCAAGGCGGG + Intronic
1151109059 17:71653857-71653879 CATTTTTGGGAGGCCGAGGTGGG + Intergenic
1151237065 17:72728328-72728350 CTTGGGAGGGATGCTGAGGTGGG + Intronic
1151310264 17:73288503-73288525 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1151352384 17:73539453-73539475 CAGGAGAGGGAGGGCCAGATGGG + Intronic
1151457632 17:74235780-74235802 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1151527429 17:74680631-74680653 CAGCTGAGGGAGGCAGAGGTGGG - Intronic
1151536508 17:74741914-74741936 CAGGAGAGGGAGACCGAAGTGGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152117658 17:78398589-78398611 CTTGCGTGGGAGGCTGAGGTGGG + Intronic
1152530315 17:80914718-80914740 CATGGGAGGGAGGCTGAGGGTGG + Intronic
1152575061 17:81136371-81136393 GTTGAGGGGGAGGCTGAGGTCGG - Intronic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1152856655 17:82668504-82668526 CATGGGAGGGAAGCTGAGGGAGG - Intronic
1152862931 17:82706144-82706166 CCAGCGAGGGAGGCCGAGGCAGG - Intergenic
1152981839 18:285274-285296 CATTTTTGGGAGGCCGAGGTGGG + Intergenic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153102918 18:1494923-1494945 TTTGGGAGGGAGGCTGAGGTGGG - Intergenic
1153192710 18:2559982-2560004 CACTATGGGGAGGCCGAGGTGGG - Intronic
1153608132 18:6855021-6855043 CATGGGAGGGAGGCCGAGGTGGG + Intronic
1153649800 18:7229864-7229886 AAAGACAGGGAGGCCGAGGCAGG + Intergenic
1153792977 18:8596462-8596484 TATGTTTGGGAGGCCGAGGTGGG - Intergenic
1154013838 18:10598669-10598691 CATGATTGGGAGGCTGAGGTGGG - Intergenic
1154073363 18:11176008-11176030 AAGGAGAGGGAAGCAGAGGTAGG - Intergenic
1154357577 18:13633511-13633533 CATCAGTGGGAGGCTGAGGCAGG - Intronic
1154514367 18:15145433-15145455 AATGTTTGGGAGGCCGAGGTGGG + Intergenic
1155098209 18:22580573-22580595 GATTACAGGGAGGCCGAGGCGGG + Intergenic
1156482916 18:37447493-37447515 CAGGAGAGGAAGGCCCAGTTCGG - Intronic
1156994599 18:43450080-43450102 AATTAAAGGGAGGCCGAGGCGGG - Intergenic
1157259883 18:46168506-46168528 CAACACTGGGAGGCCGAGGTGGG + Intergenic
1157739421 18:50079443-50079465 TGTGAGAGGGAGGCAGTGGTTGG - Intronic
1157867297 18:51197512-51197534 CAGGGGAAGGAGGCAGAGGTAGG + Intronic
1158439393 18:57460935-57460957 AATGCCAGGGAGGCTGAGGTGGG - Intronic
1158446625 18:57527757-57527779 GATGAAAGGGAGGCCGAGGCCGG - Intergenic
1159038676 18:63302079-63302101 TTTGGGAGGGAGGCCGAGGCAGG + Intronic
1159334308 18:67043767-67043789 CATGGGAGAGAGGCCAAGGTGGG + Intergenic
1160116669 18:76085177-76085199 CATGGGAGGGAGGCCAAGAGGGG - Intergenic
1160203372 18:76813432-76813454 ACTGAGGGAGAGGCCGAGGTGGG - Intronic
1160709284 19:543596-543618 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1160741874 19:690064-690086 CAGGATTGGGAGGCAGAGGTGGG + Intronic
1160780033 19:873395-873417 GATGAGATGGGGGCCCAGGTGGG + Intronic
1160962376 19:1728714-1728736 AGGGAGAGGGAGGCGGAGGTTGG + Intergenic
1160965807 19:1746391-1746413 GAGGAGGGGGAGGACGAGGTAGG + Intergenic
1161158079 19:2745000-2745022 CATCCCAGGGAGGCCGAGGGGGG + Intergenic
1161186480 19:2924841-2924863 CATTTTTGGGAGGCCGAGGTGGG - Intergenic
1161312510 19:3602788-3602810 GAAAAGAGGGAGGCCCAGGTGGG + Intronic
1161603778 19:5202995-5203017 CTTCGGTGGGAGGCCGAGGTGGG + Intronic
1161637394 19:5397493-5397515 TTTGGGAGGGAGGCCGAGGCAGG - Intergenic
1161782507 19:6302677-6302699 CTGGATTGGGAGGCCGAGGTGGG + Intergenic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162064015 19:8113876-8113898 CACGTGTGGGAGGCTGAGGTGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162766979 19:12925602-12925624 CAACACTGGGAGGCCGAGGTGGG - Intronic
1162899683 19:13787230-13787252 CATTACAGGGAGGCTGAGGCAGG + Intergenic
1162901539 19:13797897-13797919 TTTGGGAGGGAGGCCAAGGTGGG - Intronic
1163114306 19:15180033-15180055 CAGGAGAGGGAAGAGGAGGTGGG - Intronic
1164451618 19:28370905-28370927 CAGGAGCGGGAGGCGGTGGTGGG + Intergenic
1164953119 19:32355753-32355775 CACAGGAGGGAGGCCGAGGCGGG + Intronic
1165040776 19:33065998-33066020 TTTGGGAGGCAGGCCGAGGTGGG - Intergenic
1165336285 19:35172228-35172250 TTTGGGAGGGAGACCGAGGTGGG + Intergenic
1165796268 19:38521582-38521604 CCTGAGTGGGAGGCTGAGGCAGG + Intronic
1165852406 19:38857301-38857323 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166187429 19:41150283-41150305 CAGGTGAGGGAGGCTGAGGCAGG - Intergenic
1166661822 19:44652302-44652324 CAGGAGACTGAGGCTGAGGTGGG - Intronic
1166814929 19:45538472-45538494 CATTTGTGGGAGGCCGAGGTGGG + Intronic
1167080834 19:47275181-47275203 CAGGAGAGGGAGGCAGCGGCGGG - Exonic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167937750 19:52921679-52921701 GAAAATAGGGAGGCCGAGGTAGG + Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168055906 19:53865207-53865229 TTTGGGAGGGAGGCCGAGGTGGG - Intergenic
1168224887 19:54987493-54987515 CACGCCTGGGAGGCCGAGGTGGG + Intronic
1168225719 19:54993596-54993618 CATGTTAGGGAGGCCAGGGTGGG + Intronic
1168246433 19:55114977-55114999 CATGAGATGGTGGACGAGGAAGG + Intronic
1168306528 19:55438920-55438942 CATGAGTGGGAGGTGGAGGGAGG - Intronic
1202653043 1_KI270707v1_random:23920-23942 CACAAGAGGGAGGTTGAGGTGGG + Intergenic
925042024 2:739862-739884 CGTCAGAGGGAGGCAGAGATCGG + Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925994773 2:9283322-9283344 TATTACAGGGAGGCCGAGGCTGG - Intronic
926115850 2:10212898-10212920 CCAGGGAGGGAGGCTGAGGTGGG + Intergenic
926138982 2:10357213-10357235 AATGTGAGGGTGGCTGAGGTGGG + Intronic
926220869 2:10934733-10934755 AATGACAGGGAGGCAGAGGGAGG - Intergenic
927460163 2:23292080-23292102 CCTGAAAGGGAGGACCAGGTTGG - Intergenic
927705722 2:25295255-25295277 CATGATAGGGAGGCGGGGGCTGG - Intronic
927977889 2:27353683-27353705 GTTGATTGGGAGGCCGAGGTGGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928155009 2:28868764-28868786 CAGCACTGGGAGGCCGAGGTGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929014523 2:37481476-37481498 CATGGGAGGGAGGCCAAGGTGGG + Intergenic
929195562 2:39180933-39180955 CAGCACTGGGAGGCCGAGGTGGG - Intronic
929218529 2:39440235-39440257 CATTACAGGGAGGTAGAGGTTGG - Intergenic
929352146 2:40969557-40969579 CAAGATTGGGAGGCCGAGGCGGG - Intergenic
929469261 2:42175061-42175083 CCTGTAAGGGAGGCCAAGGTGGG - Intronic
929700491 2:44158873-44158895 TTTGGGAGGGAGGCTGAGGTGGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929884777 2:45868688-45868710 TTTGGGAGGCAGGCCGAGGTGGG + Intronic
930804080 2:55472587-55472609 CAGGAGAGGGAGGCCAAGGCAGG + Intergenic
931733986 2:65177684-65177706 CATGGGAGGGAGGCTGAGTGGGG - Intergenic
932215258 2:69962129-69962151 CTGGAGAGGGAGGCAGAGGAGGG + Exonic
932226546 2:70045674-70045696 CCTGGTTGGGAGGCCGAGGTGGG + Intergenic
932232071 2:70090976-70090998 CAACACTGGGAGGCCGAGGTGGG + Intergenic
932282312 2:70504163-70504185 CAACACTGGGAGGCCGAGGTGGG + Intronic
932611215 2:73201949-73201971 CTTGTGTGGGAGGCCGAGGCGGG - Intergenic
932759975 2:74432863-74432885 TGTGTGAGGGAGGCTGAGGTGGG + Intronic
933866240 2:86520783-86520805 AATAAAAGGGAGGCCCAGGTAGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935801678 2:106703385-106703407 CATGCCAGAGAGGCAGAGGTTGG - Intergenic
936757654 2:115734407-115734429 CAGCACTGGGAGGCCGAGGTGGG + Intronic
937246926 2:120499587-120499609 ATTTAGAGAGAGGCCGAGGTGGG - Intergenic
937485861 2:122314191-122314213 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
937772670 2:125739323-125739345 CATAGCAGGGAGGCTGAGGTGGG - Intergenic
937944410 2:127319262-127319284 CCTGAGAGAGAGGCTGAGGCTGG + Intronic
938493736 2:131780194-131780216 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
938514611 2:131990042-131990064 AATGTTTGGGAGGCCGAGGTGGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939837643 2:147150224-147150246 CATGGGAGGGAGGCCAATGGGGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941131015 2:161650792-161650814 CATGGGAGGGAGGCTGAGTGGGG + Intronic
941151369 2:161919188-161919210 CATGAGATGGAGGCCAAGGTGGG + Intronic
942267934 2:174247113-174247135 TGGGAGGGGGAGGCCGAGGTGGG + Intronic
942750253 2:179278485-179278507 CATGCCTGGGAGGCTGAGGTAGG + Intergenic
942792613 2:179778015-179778037 CTTGACAGGGAGGCTGAGGTGGG - Intronic
943396212 2:187338641-187338663 CATGGGAGGGAGGCAGAGGTGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944777613 2:202983125-202983147 GAGGAGTGGGAGGCTGAGGTGGG - Intronic
944833828 2:203558861-203558883 GATGATAGGGAGGCCAAGGCGGG + Intergenic
944901867 2:204223687-204223709 CATGAGAGGGAAGCCAAGCGGGG - Intergenic
945087604 2:206148540-206148562 TATGGGAGGGAGGCTGAGGCAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945395171 2:209307556-209307578 CATGGGAGGGAGGCCTAAGGGGG - Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946197496 2:218043881-218043903 CATGGGAGGGAAGCCGAGATGGG - Intronic
948360987 2:237420276-237420298 CAGGATTGGGAGGCCGAGATGGG + Intergenic
948716198 2:239865246-239865268 GATGAGCGGGAAGCAGAGGTTGG - Intergenic
949049565 2:241890194-241890216 AGTGTTAGGGAGGCCGAGGTGGG + Intergenic
1168748367 20:264074-264096 CATAGGAGGAAAGCCGAGGTGGG + Intergenic
1168848229 20:959565-959587 CATGAGAGGGAGGCCTGTGGGGG + Exonic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169548532 20:6676518-6676540 AAACAGAGGGAGGCCGAGGCAGG - Intergenic
1170014578 20:11766325-11766347 AATGAGAGGAAGGCAGGGGTAGG - Intergenic
1170458323 20:16553982-16554004 CATGGGAGGGAGGCTGAGGTGGG + Intronic
1171409115 20:24934387-24934409 GATGAGATGGAGGCCAAGGCTGG + Intergenic
1171461256 20:25299287-25299309 CTTGGGAGGCAGGCTGAGGTGGG + Intronic
1172005031 20:31813339-31813361 GATTATAGGGAGGCCAAGGTGGG + Intergenic
1172147517 20:32767136-32767158 TTTGGGAGGGAGGCTGAGGTGGG - Intronic
1172274710 20:33673405-33673427 CAAGCCAGGGAGGCCCAGGTAGG + Intronic
1172332854 20:34087793-34087815 CGTGGTGGGGAGGCCGAGGTGGG - Intronic
1172350872 20:34239461-34239483 TTTGATTGGGAGGCCGAGGTGGG - Intronic
1172541535 20:35721175-35721197 TTTGGGAGGGAGGCCGAGGTGGG - Intronic
1172703098 20:36864258-36864280 CAGGAGAGGGAAGCCGAGGCAGG - Intergenic
1172849214 20:37948511-37948533 CAGGAGAGGGAGGCTGAGGCAGG + Intergenic
1173731516 20:45332265-45332287 CTTGATTGGGAGGCTGAGGTAGG - Intronic
1174455013 20:50642693-50642715 GGTGAGAGGGAGGCAGAGATTGG - Intronic
1174575566 20:51534579-51534601 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1175099346 20:56567447-56567469 CAACACTGGGAGGCCGAGGTGGG - Intergenic
1175522593 20:59611692-59611714 CCGGAGAGGGAGGCAGGGGTAGG - Intronic
1175568634 20:60001193-60001215 GATGAGAGGGAGGGCGCGGTGGG - Intronic
1175813544 20:61872013-61872035 CTGCAGAGGGAGGGCGAGGTGGG + Intronic
1176130315 20:63494016-63494038 CGTGAGATGGAGGCGGAGCTGGG + Intronic
1176599110 21:8775731-8775753 CACAAGAGGGAGGTTGAGGTGGG - Intergenic
1176614170 21:9014182-9014204 CTTGGGAGGGAGGCTGAGGTGGG + Intergenic
1176628943 21:9119333-9119355 CACAGGAGGGAGGCTGAGGTGGG + Intergenic
1176711019 21:10149705-10149727 ATTGGGAGGGAGGCTGAGGTGGG - Intergenic
1176779164 21:13172858-13172880 AATGTTTGGGAGGCCGAGGTGGG - Intergenic
1176993164 21:15522385-15522407 CATGGAAGGGAGGTCGAGGTGGG - Intergenic
1177037457 21:16061090-16061112 CATGGGAAGGAGGCCGAGGTGGG - Intergenic
1177344681 21:19854079-19854101 CATGGGAGGGAGGCCGAGGTGGG - Intergenic
1177976813 21:27861898-27861920 AATGTTTGGGAGGCCGAGGTGGG - Intergenic
1178517847 21:33263964-33263986 CTTGCGAGGGAGGCTGAGGCAGG - Exonic
1178704702 21:34863798-34863820 CATGATTGGGAGGCCAAGGTGGG - Intronic
1178774524 21:35536910-35536932 GCTGAGGGGGAGGCTGAGGTGGG + Intronic
1178947344 21:36959357-36959379 GATGGGAGGGAGGCCGAGGAGGG + Intronic
1179802143 21:43816180-43816202 CAGGAGAGGGAGGCAGGGGCCGG - Intergenic
1179811676 21:43875223-43875245 CACGGGAGGGAGGCCGAGGAGGG - Intronic
1179934736 21:44595066-44595088 CATGTTTGGGAGGCCAAGGTAGG - Intronic
1179978292 21:44883226-44883248 TTTGGGAGGCAGGCCGAGGTGGG - Intergenic
1180025830 21:45161534-45161556 CATGAGAGGGAGGCCAACGCGGG + Intronic
1180034153 21:45234590-45234612 CAGAAGGGGGAGGCAGAGGTTGG + Intergenic
1180419320 22:12799170-12799192 CACAAGAGGGAGGTTGAGGTGGG + Intergenic
1180497939 22:15906244-15906266 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
1180673269 22:17569835-17569857 GATGAGGGGGAGGCAGAGGGAGG + Intronic
1180848082 22:18995276-18995298 CATGAGATGGGGGCACAGGTGGG - Intergenic
1180900680 22:19369683-19369705 CAACACTGGGAGGCCGAGGTGGG + Intronic
1180971107 22:19816150-19816172 CATGAGAGAGAGGCAGAGACAGG - Intronic
1181406695 22:22690065-22690087 AATGAGAGCCAGGCCGAGATGGG - Intergenic
1181414665 22:22750715-22750737 AATGAGAGGCAGGCCGAGGTGGG - Intronic
1181423035 22:22815007-22815029 AATGAGAGGCAGGCTGAAGTGGG - Intronic
1181546023 22:23603115-23603137 AATGTGTGGGAGGCTGAGGTAGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181921816 22:26326760-26326782 CCTGGGAGGAAGGCAGAGGTGGG + Intronic
1181928243 22:26377687-26377709 CATCAGAGGCAGGCGGAGGTTGG - Exonic
1182126475 22:27819499-27819521 CATGACTTGAAGGCCGAGGTGGG - Intergenic
1182176238 22:28292432-28292454 CAGGAGTTGGAGGCCGAGGTGGG - Intronic
1182345863 22:29664308-29664330 CCTGAGAGGGAGGAAGGGGTGGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182567062 22:31208046-31208068 CCCGGGAGGGAGGCTGAGGTGGG + Intergenic
1182896516 22:33863509-33863531 CAACACTGGGAGGCCGAGGTGGG + Intronic
1183024997 22:35058370-35058392 CATGGGAGGGAAGCCGAGGAGGG - Intergenic
1183143466 22:35967066-35967088 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1183478075 22:38046810-38046832 GGAGAGAGGGAAGCCGAGGTGGG + Intergenic
1183872211 22:40748523-40748545 CATGAGAGGGGACCTGAGGTGGG - Intergenic
1183964406 22:41432808-41432830 TTTGAGAGGGAGGCCAAGGTGGG + Intergenic
1183976787 22:41516974-41516996 CCAGTGATGGAGGCCGAGGTGGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184375530 22:44109865-44109887 CATAGGTGGGAGGCCGAGGCGGG + Intronic
1184523951 22:45010366-45010388 TATCAGAGGGAGGCGGAGGAGGG - Intergenic
1184783175 22:46659166-46659188 GCTGAGAGGGAGGCCGAAGCAGG - Intronic
1184783184 22:46659206-46659228 GCTGAGAGGGAGGCCGAAGCAGG - Intronic
1185324430 22:50218769-50218791 CTTGAGAGCGAGGGAGAGGTTGG + Exonic
949475644 3:4442503-4442525 CATGGTGGGGAGGCCGAGGCGGG - Intronic
949935016 3:9109857-9109879 CAGGAGAGGGAGGAGCAGGTAGG + Intronic
949967666 3:9372331-9372353 TTTGGGAGGGAGGCCGAGGCAGG + Intronic
950910980 3:16591539-16591561 CTTCAGAGGGAGGCTGAGGTAGG - Intronic
951014552 3:17715810-17715832 AAGGGGGGGGAGGCCGAGGTGGG + Intronic
951406370 3:22304022-22304044 CAACACTGGGAGGCCGAGGTGGG - Intronic
951410170 3:22353761-22353783 GATGAGAGTGTGGCTGAGGTAGG - Intronic
952142429 3:30494657-30494679 TATGTTTGGGAGGCCGAGGTGGG - Intergenic
952793296 3:37217424-37217446 TACGAGAGGGAGGCTGAGGTGGG + Intergenic
952819026 3:37470041-37470063 CAGCACTGGGAGGCCGAGGTGGG - Intronic
953402976 3:42642832-42642854 CATGTGGGGGAGGTGGAGGTAGG - Intronic
953606079 3:44414199-44414221 CATGAGTGGGAGGCCAGGCTTGG + Intergenic
953618531 3:44512844-44512866 CACTTGTGGGAGGCCGAGGTGGG - Intergenic
953991552 3:47487849-47487871 CAGCACTGGGAGGCCGAGGTAGG - Intergenic
954058054 3:48044514-48044536 CAGCACTGGGAGGCCGAGGTGGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954574357 3:51667410-51667432 CATCACTGGGAGGCCGAGGAGGG - Exonic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
955283276 3:57614728-57614750 TAGCAGAGGGAGGCCGAGGCGGG + Intergenic
955373853 3:58377530-58377552 CTCGAGAGGCAGGCTGAGGTGGG + Intronic
955912092 3:63867639-63867661 CATTTGAGGTAGGCCGAGGCGGG + Intronic
956033160 3:65061310-65061332 AATGAGAGGGAGGCTGTGGTTGG + Intergenic
957787921 3:84905310-84905332 CATGGGAGGGAGCCCGAGAGGGG + Intergenic
958019704 3:87980718-87980740 AATGGGAGAGAGGCCGAGGGGGG - Intergenic
958675625 3:97265372-97265394 GATGAGAGAGAAGCCGATGTTGG - Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959689449 3:109182760-109182782 GATGAGAGAGAGGCTGAGTTGGG - Intergenic
960011182 3:112835732-112835754 CATGGGAGAAAGGCCGAGGGGGG - Intronic
960025120 3:113000140-113000162 CATTTTTGGGAGGCCGAGGTGGG + Intronic
960336211 3:116420622-116420644 TTTGGGAGGGAGGCCAAGGTGGG + Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961464549 3:127073305-127073327 CAGGAGAGGAAGGCCTAGGAGGG - Intergenic
961525772 3:127496478-127496500 CATGGCAGGGAGGCTGAGGCAGG + Intergenic
961669211 3:128516869-128516891 CATAAGAGGGAGGCAGAAGTGGG + Intergenic
961763492 3:129189562-129189584 CTTGGGAGGGAGGCTGAGGCAGG - Intergenic
961943012 3:130656758-130656780 CACGAGAGGGAGTCCAAGGGGGG - Intronic
963140566 3:141943003-141943025 CAACACTGGGAGGCCGAGGTGGG - Intergenic
963250146 3:143095581-143095603 CATGGAAGGGAGGCTGAAGTGGG + Intergenic
963738656 3:149051909-149051931 CAACACTGGGAGGCCGAGGTGGG + Intronic
963801417 3:149679699-149679721 CCTGAGAGGGAGCCAAAGGTTGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964615090 3:158655237-158655259 CAGGAGTGGGAGGCCAAGGCGGG + Intronic
964987188 3:162758164-162758186 CGTGGTTGGGAGGCCGAGGTGGG + Intergenic
965072823 3:163937737-163937759 CATGAGAGGGACCCAGAGGGAGG - Intergenic
965074010 3:163953598-163953620 CATAGGAGGGAGGCTGGGGTGGG - Intergenic
965367724 3:167820624-167820646 CATGGGAGGGAGGCCAAGAGGGG + Intronic
965583471 3:170293925-170293947 CATGCTGGGGAGGCTGAGGTGGG - Intronic
965693652 3:171383943-171383965 CTTTAAAGGGAGGCTGAGGTTGG - Intronic
965748512 3:171951519-171951541 TTTGGGAGGGAGGCTGAGGTGGG - Intergenic
965778004 3:172254024-172254046 AAAAAGAAGGAGGCCGAGGTGGG - Intronic
965863828 3:173181234-173181256 CATGTATGGGAGGCCGATGTGGG - Intergenic
965946998 3:174255187-174255209 AAAGATTGGGAGGCCGAGGTGGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967030056 3:185597598-185597620 CTTTGGTGGGAGGCCGAGGTGGG - Intronic
967069661 3:185951862-185951884 CATGCCTGGGAGGCGGAGGTTGG - Intergenic
968296094 3:197577578-197577600 CATTACAGGGAGGCCGGGGGAGG + Intergenic
968424377 4:512459-512481 AATGGTTGGGAGGCCGAGGTGGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968699397 4:2047471-2047493 CAGGAGACAGAGGCGGAGGTGGG + Intergenic
968769953 4:2498777-2498799 CAAGTGTGGGAGGCTGAGGTAGG + Intronic
968808520 4:2789801-2789823 CAGGAGAGGGAGGATGAGGCAGG + Intergenic
968919619 4:3515734-3515756 CCTGAGATGGAGGCCCAGGGAGG - Intronic
968932171 4:3586923-3586945 AATGAGAGGAAGGTCCAGGTAGG - Intronic
968937827 4:3622303-3622325 CATTTGTGGGAGGCCAAGGTGGG - Intergenic
969312188 4:6360157-6360179 GAGGAGAGGGAGGCCCAGGGTGG + Intronic
970395467 4:15660828-15660850 CAACACTGGGAGGCCGAGGTGGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970688442 4:18594468-18594490 AATGGTTGGGAGGCCGAGGTGGG - Intergenic
971550351 4:27947423-27947445 CATCAGAGGGAGGCTGAATTGGG + Intergenic
971789341 4:31148330-31148352 CTTGGGAGAGAGGCTGAGGTGGG - Intergenic
972318587 4:37951008-37951030 CATTGGTGGGAGGCCGAGGAGGG - Intronic
972378369 4:38495182-38495204 ATTTAGTGGGAGGCCGAGGTGGG - Intergenic
972426173 4:38935161-38935183 CAGCTGTGGGAGGCCGAGGTGGG - Intronic
972629505 4:40831149-40831171 CAGCACTGGGAGGCCGAGGTGGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973328168 4:48885095-48885117 ACTGAGAGGGAGGCTGAGGCAGG - Exonic
973340505 4:48998746-48998768 GAGGAGGGGGAGGCGGAGGTAGG - Intronic
973362468 4:49178103-49178125 CACAAGAGGGAGGTTGAGGTGGG - Intergenic
973534566 4:51867951-51867973 CACGAGGGGGAAGCCGAGGGGGG - Intronic
973768131 4:54182256-54182278 CAGGCGTGGGAGGCCGAGGCAGG - Intronic
974036515 4:56822503-56822525 CTTGGGAGGGAGGCTGAGGTGGG - Intergenic
974179002 4:58360638-58360660 CATGGGAGGGAGACTGAGGTGGG - Intergenic
974260331 4:59518128-59518150 CATGGGAGAGAGGCTGAGGTTGG - Intergenic
974266700 4:59595113-59595135 TATGGGAGGGAGGCTGAGATGGG - Intergenic
974311369 4:60214608-60214630 CTTGAAAGGAAGGCTGAGGTGGG - Intergenic
974420103 4:61662524-61662546 CATGGGAGGGAGGCCAAAGGTGG + Intronic
974686863 4:65242288-65242310 CATGGGATGGAGGCTGAGGAGGG - Intergenic
975336570 4:73183564-73183586 GAAGAGAAGGAGGCTGAGGTGGG - Intronic
975635696 4:76445816-76445838 CATGAGAGGGAGGAAGAAGGTGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976154251 4:82125626-82125648 CACCACAGGGAGGCCAAGGTAGG - Intergenic
976323961 4:83750144-83750166 CATCCTTGGGAGGCCGAGGTGGG + Intergenic
977303552 4:95295976-95295998 CATGGGGGGGAGGCTGAGGCAGG + Intronic
977310069 4:95374709-95374731 CTGGAGAGGGAGGCCCAGGGTGG + Intronic
977359042 4:95980912-95980934 CATGGGAGGGAGGCTGATGGGGG + Intergenic
977799360 4:101207578-101207600 CAGCACTGGGAGGCCGAGGTGGG + Intronic
977938693 4:102834635-102834657 CATACTAGGGAGGCTGAGGTGGG + Intronic
978141336 4:105320684-105320706 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
978241460 4:106521497-106521519 CTGGAGGGGGAGGCTGAGGTGGG - Intergenic
978347691 4:107788758-107788780 CATGGGAGGGAGGCCAAAGTGGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978498427 4:109384459-109384481 CATGAGAGGGAGACTGAGTCAGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979637989 4:122978704-122978726 TATGTGAGGGAGGCTGAGGGTGG - Intronic
979649007 4:123107740-123107762 CATGGGAGGGAGGCTGAGGAGGG - Intronic
979790805 4:124779142-124779164 AATTAGAGGGAGGCCGAGTCAGG - Intergenic
980730990 4:136824073-136824095 CATGGGAGGGATGCAGACGTGGG - Intergenic
981061873 4:140433408-140433430 CAGGATTGGGAGGCCGAGGCGGG + Intergenic
981175828 4:141682708-141682730 CAATAGGGGGAGGCCGAGGCGGG + Intronic
981308760 4:143274866-143274888 CAGGAGATGGAGACTGAGGTAGG + Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982110796 4:152051673-152051695 CAACACAGGGAGGCCGAGGCAGG - Intergenic
982158097 4:152540731-152540753 CATGGGAGGGAGGCAAGGGTTGG - Intergenic
982545162 4:156724472-156724494 CATGGGAGGGAGGTGGAGGTGGG + Intergenic
982802648 4:159723264-159723286 CATGGGAGGGAGGCTGAAGGAGG - Intergenic
982846457 4:160259181-160259203 CAGCATTGGGAGGCCGAGGTGGG - Intergenic
982856270 4:160385883-160385905 CGTGAGAGGAAGGCCAAGGAGGG - Intergenic
983301294 4:165929290-165929312 AAGTAGAGGGAGGCCAAGGTGGG + Intronic
983407800 4:167352354-167352376 TATATGTGGGAGGCCGAGGTGGG - Intergenic
983445025 4:167839394-167839416 AATTTGAGGGAGGCCAAGGTAGG - Intergenic
983491853 4:168398398-168398420 CATGGGAGGGAGGCCAAAGTGGG + Intronic
983532926 4:168830276-168830298 CACGCCTGGGAGGCCGAGGTGGG + Intronic
983629592 4:169836570-169836592 CATGTGCTGGAGGCTGAGGTGGG + Intergenic
984169480 4:176343486-176343508 CACAGGAGGGAGGCTGAGGTGGG - Intergenic
984191612 4:176612868-176612890 GATTAGAGGGAGACAGAGGTTGG - Intergenic
984273199 4:177573543-177573565 CATCCTTGGGAGGCCGAGGTGGG - Intergenic
984325150 4:178241862-178241884 CATGGAAGGGAGGCCAAGGAGGG + Intergenic
984653785 4:182296023-182296045 CAGGAGGTGGAGGCTGAGGTGGG - Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984947056 4:184977461-184977483 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
986827820 5:11540754-11540776 CATGATTGGTAGGCTGAGGTGGG - Intronic
987573272 5:19693604-19693626 CATGAGAGGAAGGCCAAGCATGG + Intronic
988204434 5:28115684-28115706 CATGGGAGGCAGGGCGGGGTGGG - Intergenic
988293928 5:29330056-29330078 ATTGGGAGGGAGGCCAAGGTGGG - Intergenic
988346330 5:30042094-30042116 CATGGGAGTGAGGCTGAGGGGGG + Intergenic
988643161 5:33064275-33064297 CAGTAGAAGGAGGCTGAGGTGGG - Intergenic
989038099 5:37196678-37196700 CACTTTAGGGAGGCCGAGGTGGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990035743 5:51317126-51317148 TATCTGGGGGAGGCCGAGGTGGG - Intergenic
990183956 5:53192627-53192649 CATAAGAGAGAGGCAGAGGGGGG + Intergenic
990210775 5:53480162-53480184 TGTGAGAGGGAGGGCGCGGTGGG - Intergenic
991359342 5:65803336-65803358 CATGGGAGGGAAGCTGAGGGGGG - Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991680390 5:69134197-69134219 TACGATAGGGAGGCTGAGGTGGG - Intergenic
991956320 5:71998806-71998828 GAGGAGAAGGAGGCTGAGGTAGG + Intergenic
992712406 5:79472526-79472548 CAGGAATGGGAGGCTGAGGTAGG + Intronic
993703390 5:91143867-91143889 CATGGGAGGGAGGCTGAGGGGGG - Intronic
993721023 5:91322126-91322148 TTTGAAAGGGAGGCTGAGGTGGG + Intergenic
993987013 5:94609700-94609722 CAGGAGTGGGAGGCCGAGGCAGG + Intronic
994362997 5:98876920-98876942 CATGACTGGGAGGCCAAGGCAGG + Intronic
994753266 5:103764514-103764536 CATGAGAGGGAGGCTGAGAGAGG - Intergenic
994891260 5:105639580-105639602 CATGGGAAGGAGGCCGAGTGGGG + Intergenic
995118438 5:108508301-108508323 CATGACGGGGAGGCCAAGGAGGG + Intergenic
995568974 5:113459289-113459311 TTTGGGAGGGAGGCCGAGGCGGG + Intronic
995827021 5:116312017-116312039 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
996044466 5:118854942-118854964 CAGCAGCAGGAGGCCGAGGTGGG + Intronic
996364660 5:122688368-122688390 GATGTCAGGGAGGCCGAGATGGG - Intergenic
996391582 5:122968105-122968127 CTTGATTGGGAGGCCGAGGCAGG + Intronic
996924344 5:128806518-128806540 GATAGGAGGGAGGCTGAGGTAGG - Intronic
997343062 5:133161692-133161714 CATGAGAAGGAGGCAGAGGGAGG + Intergenic
997552943 5:134769650-134769672 CAGGGGTGGGAGGCCGAGGCAGG - Intronic
997569631 5:134916176-134916198 CATGGGAGGGAGGCTAGGGTTGG + Intronic
998072437 5:139208636-139208658 CTTTAGAGGGAGGCCGAGGTGGG - Intronic
998894860 5:146788482-146788504 CACGTTTGGGAGGCCGAGGTGGG + Intronic
999150764 5:149424457-149424479 CATGTGAAGGAGGCAGGGGTTGG + Intergenic
999734273 5:154500964-154500986 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
999903179 5:156109699-156109721 CATGAGATGGAGGCTGAAGGGGG - Intronic
999998707 5:157117228-157117250 CATGCCTGGGAGGCTGAGGTAGG + Intronic
1000018374 5:157298441-157298463 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000659626 5:163921171-163921193 CATGGGAGGGAGCCCATGGTTGG + Intergenic
1000980701 5:167813673-167813695 AGTGAGAGGGAGGGGGAGGTTGG - Intronic
1001163694 5:169344254-169344276 AATTATTGGGAGGCCGAGGTGGG + Intergenic
1001240520 5:170066194-170066216 CATTTGCGGGAGGCCGAGGTGGG - Intronic
1001393616 5:171401108-171401130 TTTGGGAGGGAGGCCAAGGTGGG + Intronic
1001437577 5:171712203-171712225 AATGAGAGGCAGGCTGAGGGTGG - Intergenic
1001457949 5:171880940-171880962 CACTTTAGGGAGGCCGAGGTGGG - Intronic
1002027850 5:176407548-176407570 CAGCAGTGGGAGGCTGAGGTGGG - Intronic
1002285617 5:178160925-178160947 CCTGTAAGGGAGGCCGAGGTGGG - Intergenic
1002313665 5:178329690-178329712 CAGGACCGGGAGGCCGAGGCAGG + Intronic
1002434884 5:179225154-179225176 CATGAGAGGGAGGAGGAGCCTGG - Intronic
1002525946 5:179816392-179816414 CAGCACTGGGAGGCCGAGGTGGG - Intronic
1002600623 5:180352543-180352565 CACGAGAGGGAGTCCGGGGCGGG - Intronic
1002619612 5:180478398-180478420 TGTGAAAGGGAGGCTGAGGTGGG + Intergenic
1003081525 6:3025251-3025273 CTTTAAAAGGAGGCCGAGGTGGG + Intergenic
1003202987 6:3980121-3980143 GCTGATAGGGAGGCTGAGGTAGG - Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1004214142 6:13685817-13685839 AATGGGAGGGAGGCTGAGGTGGG + Intronic
1004363687 6:14993950-14993972 TTTGGGAGGGAGGCCAAGGTGGG + Intergenic
1004513888 6:16305871-16305893 CAAGAGAGTGAGGCAGAGGGAGG + Exonic
1004709637 6:18156666-18156688 CAATATTGGGAGGCCGAGGTGGG + Intronic
1005998290 6:30945533-30945555 GCTGACAGGGAGGCTGAGGTGGG + Intronic
1006131890 6:31874647-31874669 CACGAGAGGGAGGGGGAGTTGGG - Intronic
1006647327 6:35523605-35523627 CAACAGTGGGAGGCCGAGGCAGG + Intergenic
1006760749 6:36458290-36458312 CATTTTTGGGAGGCCGAGGTGGG + Intronic
1006766372 6:36510230-36510252 CATGAGAGGGAGGCCAAGCAGGG - Intronic
1007351073 6:41273876-41273898 CATGAGAGGAGAGCCGAGGGTGG - Intronic
1007423859 6:41734895-41734917 CCTGAGAGGGGGTCGGAGGTAGG - Intronic
1007425461 6:41743463-41743485 CCTGAGCGAGAGGCTGAGGTGGG - Intronic
1007539760 6:42630430-42630452 CCAGCAAGGGAGGCCGAGGTGGG - Intronic
1008231563 6:48989974-48989996 CATGAGAGAGAGGCTGAAGTGGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008578753 6:52886168-52886190 CATGACAGGGAGGACCAGGAAGG + Intronic
1009243410 6:61205162-61205184 CATGGGAGGGAGACTGAGGGGGG - Intergenic
1010009829 6:71037073-71037095 TATAAGAGGGAGGCAGAGGGAGG + Intergenic
1011476672 6:87755441-87755463 TATAAGAGGGAGGCAGAGGGCGG - Intergenic
1011516043 6:88154823-88154845 CACTTGTGGGAGGCCGAGGTGGG - Intronic
1011587762 6:88945082-88945104 CCTGAGAAGGAGGCAGGGGTTGG - Intronic
1011779825 6:90775398-90775420 CAAGAGAGGGAGCCAGAGCTAGG - Intergenic
1012142057 6:95636618-95636640 CATGGGAGGGAGGCTGAGGTAGG - Intergenic
1012728620 6:102850077-102850099 CACTAGAGGGAGGCCTAGGCGGG + Intergenic
1012749560 6:103140486-103140508 CACAGGAGGGAGGCCAAGGTGGG - Intergenic
1012889889 6:104885807-104885829 CACAAGAGGGAGGCCAAGGTGGG + Intergenic
1013086775 6:106864000-106864022 CATGGGAGAGAAGTCGAGGTGGG - Intergenic
1013315454 6:108937940-108937962 TTTGGGAGGGAGGCCAAGGTGGG - Intronic
1013572203 6:111440176-111440198 ACTAGGAGGGAGGCCGAGGTAGG - Intronic
1014391632 6:120872248-120872270 CATGGGAGGGAGGCTGAGAAGGG + Intergenic
1014757079 6:125313180-125313202 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1014969033 6:127791737-127791759 CATGGGAGGGAGGGTGAGGTGGG - Intronic
1015400238 6:132780343-132780365 CATAAGTGGGAGGCTGAGGTGGG - Intronic
1015839116 6:137457204-137457226 CAAGAGAGCCAGGCAGAGGTGGG + Intergenic
1015954290 6:138583850-138583872 CATATGAGGGAGGCCAAGGTGGG + Intronic
1016085813 6:139913054-139913076 TATGATAGGGAGGCCGAGGCGGG + Intergenic
1017029142 6:150205544-150205566 CATGCTTGGGAGGCTGAGGTGGG + Intronic
1017522399 6:155213754-155213776 CATGGGAGGCAGGCCAAGGAGGG - Intronic
1018361483 6:163074880-163074902 CTGGAGTGGGAGGCTGAGGTGGG + Intronic
1018472454 6:164108856-164108878 GTTGAGAGGGAGGGTGAGGTGGG - Intergenic
1019335646 7:481309-481331 CTCCAGAGGAAGGCCGAGGTGGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019497440 7:1347039-1347061 GCTGAGAGGCAGGCTGAGGTCGG - Intergenic
1019615766 7:1959803-1959825 CAGGTGAGGGAGGACGAGGGCGG + Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019962666 7:4473789-4473811 CATGTTTGGGAGGCCGAGGCGGG + Intergenic
1019965316 7:4494094-4494116 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1019971938 7:4548523-4548545 TATGAGAGTGAGGGAGAGGTTGG - Intergenic
1020035306 7:4960027-4960049 GAAGAGAGGGACTCCGAGGTTGG + Intergenic
1020150909 7:5680991-5681013 CATGAGAGGGAGTGAGGGGTGGG - Intronic
1020160602 7:5768319-5768341 CAGTAGTGGGAGGCCGAGGCAGG + Intronic
1020303882 7:6817764-6817786 CAGCACTGGGAGGCCGAGGTGGG + Intronic
1020314977 7:6899197-6899219 TTTGGGAGGGAGGCTGAGGTAGG + Intergenic
1020672702 7:11137830-11137852 CACTTTAGGGAGGCCGAGGTGGG - Intronic
1020783309 7:12542613-12542635 CATTAGGAGGAGGCTGAGGTGGG - Intergenic
1021405909 7:20267138-20267160 TAGAAGAGGGAGGCCTAGGTGGG - Intergenic
1021417177 7:20401084-20401106 CTTGGGAGGGAGGCTGAGGCAGG - Intronic
1021728343 7:23571739-23571761 CCTGCTAGGGAGGCTGAGGTGGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022412021 7:30146443-30146465 CAGTATAGGGAGGCCGAGGGCGG + Intronic
1023054865 7:36283332-36283354 CAGGTGAGGGAGGCAGAGGAAGG + Intronic
1023288419 7:38643622-38643644 AATGGTTGGGAGGCCGAGGTGGG - Intergenic
1023772971 7:43575962-43575984 TTTGGGAGGGAGGCCGAGGTGGG - Intergenic
1023777548 7:43622332-43622354 AATGAGTGGGAGGAAGAGGTTGG - Intronic
1023964261 7:44954217-44954239 CAAGAGCGGGAGGCTGAGGCAGG - Intergenic
1024008098 7:45242000-45242022 CATCATAGGGAGGCAGTGGTGGG - Intergenic
1024284396 7:47744604-47744626 CACTATCGGGAGGCCGAGGTGGG + Intronic
1024326759 7:48114888-48114910 GAGGAGAGGGAGGTGGAGGTTGG + Intergenic
1024480467 7:49856761-49856783 CATGATTGGGAGGCCGAGGTGGG + Intronic
1024778135 7:52812326-52812348 AAGGATTGGGAGGCCGAGGTGGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026158039 7:67844461-67844483 CTTGGGAGGGAGGCTGAGATGGG - Intergenic
1026392071 7:69912038-69912060 CACAAGAGGGAGGCCAAGGTAGG - Intronic
1026405994 7:70065952-70065974 CCTGAGAAGGAGGCTGAGGCAGG - Intronic
1026699284 7:72625548-72625570 CAGGAGCGGGAGGCTGAGGTGGG + Intronic
1026884094 7:73927864-73927886 CAGCACTGGGAGGCCGAGGTGGG - Intergenic
1026976223 7:74500334-74500356 TTTGGGAGGGAGGCCAAGGTGGG + Intronic
1027221576 7:76217529-76217551 CGTGATTGGGAGGCCGAGGTGGG - Intronic
1027911773 7:84260711-84260733 CATGGGAAGGAGGCCAAGGGGGG + Intronic
1028136727 7:87230436-87230458 CATGGGAGGGAGGCTGATGGGGG + Intergenic
1028308230 7:89293675-89293697 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1028527452 7:91801530-91801552 CATGGGAGGGAGGCCAAGGAGGG - Intronic
1029296788 7:99546605-99546627 CAGCAGTGGGAGACCGAGGTGGG - Exonic
1029404415 7:100366198-100366220 CAGGATTGGGAGGCCAAGGTGGG - Intronic
1029449687 7:100633818-100633840 GATACGAGGGAGGCCGAGGCAGG - Intronic
1029457160 7:100677163-100677185 TATGCGGGGGAGGCTGAGGTGGG + Intronic
1029569824 7:101362287-101362309 CTAGATTGGGAGGCCGAGGTGGG - Intergenic
1029653453 7:101909302-101909324 CAGGTTTGGGAGGCCGAGGTGGG + Intronic
1029977556 7:104849036-104849058 CTTGGGTGGGAGGCTGAGGTGGG - Intronic
1030056307 7:105586673-105586695 CAGGAGAGTGAGGCCTGGGTAGG - Intronic
1030091461 7:105862325-105862347 CTTGGGAGGGAGGCTGAGGTGGG + Intronic
1030359414 7:108579618-108579640 CATGGGAGGGAGGCTGAGGTGGG + Intergenic
1030507440 7:110442582-110442604 CAAGAGAGGGAGTCTTAGGTTGG - Intergenic
1030570240 7:111213325-111213347 CATGGGAGGGAGGCTGAGTGGGG + Intronic
1030889675 7:114983815-114983837 CCTGATGGGGATGCCGAGGTGGG - Intronic
1031837070 7:126691167-126691189 CATGAGAGGGAGGCCAAGAAGGG - Intronic
1032188775 7:129750601-129750623 CAGGAGAGGGAGGCCATGATGGG - Intronic
1032232188 7:130084529-130084551 TTTGGGAGGGAGGCCAAGGTGGG + Intronic
1032514992 7:132500197-132500219 AATTGGAGGGAGGCCGAGGTGGG + Intronic
1032576604 7:133061129-133061151 CCTAAGAGGAAGGCCGGGGTGGG + Intronic
1032850055 7:135786599-135786621 CTTGATTGGGAGGCCGAGGTGGG - Intergenic
1033074294 7:138234149-138234171 CTTGGGAGGAAGGCTGAGGTGGG + Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033370334 7:140701514-140701536 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1033811588 7:145019251-145019273 AATGTGGTGGAGGCCGAGGTGGG + Intergenic
1033911515 7:146269048-146269070 CATAAGAGGGTGGGCCAGGTGGG + Intronic
1034496887 7:151428486-151428508 CATGGGAGGGAGGCCCAGGAAGG + Intergenic
1034821898 7:154223671-154223693 GATGAGAGGAAGGAAGAGGTGGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1034995293 7:155573115-155573137 CACTTGAGGGAGGCCGAGGCAGG + Intergenic
1035189609 7:157154075-157154097 CTTGGGAGGGAGGCCGAGGTGGG + Intronic
1035252442 7:157606051-157606073 CATGGGAGGGAAGCCGAAGGAGG - Intronic
1036949074 8:13123592-13123614 TTTGGGAGGGAGGCCGAGGCAGG - Intronic
1038290148 8:26241932-26241954 CCTGGGAGGGAGGCTGAGGTGGG + Intergenic
1038504196 8:28070502-28070524 CATGCCTGGGAGGCCAAGGTGGG + Intronic
1038550692 8:28465991-28466013 CATGCCTGGGAGGCCGAGGCCGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038745648 8:30252572-30252594 CATGAGAGGGAGGCCCTTGCTGG + Intergenic
1038785620 8:30612636-30612658 CAGGAGAGGGAGGCTGAGGCAGG - Intronic
1038925883 8:32138821-32138843 AATCCTAGGGAGGCCGAGGTGGG - Intronic
1038939773 8:32291648-32291670 CTTGAGAGGAAGGCTGAGGCAGG - Intronic
1039516370 8:38137154-38137176 CTTTGGTGGGAGGCCGAGGTGGG + Intronic
1039593741 8:38771845-38771867 CTTGGGAGGGAGGCTGAGTTGGG - Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040937324 8:52795205-52795227 CATCTTTGGGAGGCCGAGGTGGG + Intergenic
1041305003 8:56448594-56448616 CAGGAGCGGGAGGCTGAGGTAGG + Intergenic
1041871325 8:62637783-62637805 CATGAGAGTGAGGCCAACGAGGG + Intronic
1042026875 8:64433335-64433357 CAAGATAGGGAGGCTGAGGAAGG + Intergenic
1042586341 8:70343563-70343585 TTTGGGAGGGAGGCCGAGGCGGG + Intronic
1042608974 8:70577169-70577191 CACGAGAGGGAGGCCGAGGGGGG + Intronic
1042824152 8:72963297-72963319 CCTGGCAGGGAGGCCAAGGTGGG + Intergenic
1042856572 8:73273504-73273526 CACAGGAGGGAGGCCGAGGTGGG + Intergenic
1043702887 8:83313024-83313046 CATGGGAGGGAGGCCTATGGGGG - Intergenic
1043750355 8:83926616-83926638 CATGGGAGGGAGGCTGAAGGGGG - Intergenic
1043798695 8:84579125-84579147 CATGGGAGGGAGGCCTAGGGGGG - Intronic
1044444921 8:92264637-92264659 CTTGGGAGGGAGGCTAAGGTGGG + Intergenic
1044774998 8:95678398-95678420 CATGGGAGTGAGGCCGAGGGGGG - Intergenic
1044992271 8:97806708-97806730 CATGAGATTGAGGCCGAGGCTGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045274464 8:100690222-100690244 TTTGAGAGGGAGGACAAGGTGGG + Intronic
1045459811 8:102415648-102415670 CATAGATGGGAGGCCGAGGTGGG - Intergenic
1045519224 8:102888807-102888829 CAGGAGGGGGAGGCTAAGGTGGG + Intronic
1045888005 8:107122832-107122854 CATGGAAGGGAGGCCAAGGCAGG + Intergenic
1046395318 8:113632968-113632990 CAGGAGAGGGAGGCCAAGGTGGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046674710 8:117094839-117094861 CATGGGAAGGAGGCTGAGGTGGG - Intronic
1046682126 8:117182157-117182179 CATGAGAAGGAGAGTGAGGTGGG + Intergenic
1047056760 8:121173718-121173740 CATGAGAGGGAACCCGTGGGAGG - Intergenic
1047261260 8:123262591-123262613 CAACACAGGGAGGCAGAGGTGGG - Intronic
1047858331 8:128936969-128936991 CAGGAAAGGGAGGCCGGGGTGGG + Intergenic
1048548003 8:135404939-135404961 CATGGGAGGGAGGCTGAGTGGGG - Intergenic
1049010127 8:139881920-139881942 CATCAGAGGGAGGCCCAGGCAGG - Intronic
1049091449 8:140517651-140517673 CATCACTGGGAGGCCGAGGTGGG - Intergenic
1049141637 8:140960454-140960476 CAACACTGGGAGGCCGAGGTGGG - Intronic
1049708204 8:144052372-144052394 TAGGAGCGGGAGGGCGAGGTGGG - Intronic
1050563509 9:6858525-6858547 CATGGTTGGGAGGCCTAGGTGGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051029656 9:12658712-12658734 CACGAGAGGGAGGCCAAGGCGGG - Intergenic
1051224553 9:14885168-14885190 AATGATGGGGAGGCCGAGGCGGG - Intronic
1051338245 9:16086550-16086572 AATGATAGGGAGGCTGAGGCGGG - Intergenic
1051441466 9:17087755-17087777 CAATTCAGGGAGGCCGAGGTGGG + Intergenic
1052552596 9:29970025-29970047 CATGGGAGGGAGACCGAAGGTGG - Intergenic
1053619190 9:39798736-39798758 CATGGGAAGGAGGCTGAAGTGGG - Intergenic
1053895316 9:42736603-42736625 CATGGGAAGGAGGCTGAAGTGGG + Intergenic
1054264967 9:62908693-62908715 CATGGGAAGGAGGCTGAAGTGGG + Intergenic
1055044129 9:71907755-71907777 TTTGGGAGGGAGGCCGAGGCAGG - Intronic
1055451630 9:76436196-76436218 TATAAGATGGAGGCCGAGGTAGG - Intronic
1055890949 9:81122862-81122884 CATGGTAGGGAGGCCAAGGGAGG - Intergenic
1056167209 9:83951023-83951045 TTTGGGAGGGAGGCCGAGGTGGG + Intronic
1056662730 9:88556429-88556451 CATGAGAGGGGACCCGAAGTGGG + Intronic
1056898980 9:90581063-90581085 CATGCCTGGGAGGCTGAGGTGGG + Intergenic
1057102330 9:92374450-92374472 AAAGATTGGGAGGCCGAGGTGGG - Intronic
1057194797 9:93110951-93110973 CATGAGAGAGAGACGGAGGAAGG - Intronic
1057510864 9:95678613-95678635 CATGGGAGGGAGGCTGAGCAGGG - Intergenic
1057550501 9:96048403-96048425 GAAGAGAGGGAGGAGGAGGTTGG + Intergenic
1057616382 9:96594427-96594449 CAGGAGAGGGTGGCCGCAGTTGG + Intronic
1057776426 9:98014159-98014181 TATGATTGGGAGGCCGAGGCGGG + Intronic
1057833633 9:98426752-98426774 TTTGGGAGGGAGGCCGAGGTGGG + Intronic
1058270691 9:102968149-102968171 TATGAGAGTGAGGCTGAGGGGGG - Intergenic
1059091829 9:111367799-111367821 TTTGAGAGGGAGGCCAAAGTGGG + Intronic
1059349182 9:113652295-113652317 AATTATTGGGAGGCCGAGGTGGG + Intergenic
1059678693 9:116565578-116565600 CAGGAGACTGAGGCTGAGGTGGG - Intronic
1059880691 9:118685708-118685730 CCTGAGAGGTAAACCGAGGTGGG + Intergenic
1060827879 9:126696723-126696745 GAGGCGATGGAGGCCGAGGTGGG - Exonic
1061017482 9:127990323-127990345 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1061182095 9:129030358-129030380 CATGACAGGATGGCCCAGGTAGG - Intergenic
1061273132 9:129555100-129555122 CATGCCTGGGAGGCTGAGGTGGG + Intergenic
1061756743 9:132818734-132818756 CTTCAGTGGGAGGCCGAGGCGGG + Intronic
1062214598 9:135382417-135382439 CATGAGCGTGAAGCCGAGGAAGG + Intergenic
1062329086 9:136028956-136028978 CACAAGAGGGAGGCCGAGGTGGG + Intronic
1062458948 9:136654883-136654905 GCTGGGAGGGAGGCCGAGGCTGG + Intergenic
1062663277 9:137651539-137651561 TGTGGGAGGGAGGCCGAGGCAGG + Intronic
1202795778 9_KI270719v1_random:118694-118716 ATTGGGAGGGAGGCTGAGGTGGG - Intergenic
1203691596 Un_GL000214v1:47791-47813 CACAAGAGGGAGGTTGAGGTGGG - Intergenic
1203644699 Un_KI270751v1:56400-56422 CACAAGAGGGAGGTTGAGGTGGG + Intergenic
1185595702 X:1305510-1305532 CATGAGGTGGAAGACGAGGTAGG + Exonic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1185938652 X:4288377-4288399 CATAAGACGGAGGCAGAGATAGG - Intergenic
1186689065 X:11955503-11955525 TATGTTTGGGAGGCCGAGGTGGG + Intergenic
1186704098 X:12123852-12123874 CAGGAGTGGGAGACCAAGGTGGG - Intergenic
1187669522 X:21655882-21655904 GACGAGAGGGAGGGAGAGGTTGG - Exonic
1187701098 X:21965040-21965062 CATAAGACGGAGGCAGAGATTGG - Intronic
1187970775 X:24655869-24655891 CATTAGGGGGAGGCCAAGGCAGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188371060 X:29369869-29369891 CATGACAAGGAGTCCGAGGTAGG - Intronic
1188434840 X:30148393-30148415 CACGGGAGGGAGGCCAACGTGGG + Intergenic
1189394609 X:40609866-40609888 CATGCCTGGGAGGCTGAGGTAGG + Intergenic
1189463167 X:41258763-41258785 CCAGATTGGGAGGCCGAGGTGGG + Intergenic
1189787376 X:44571571-44571593 CATGAGGGGAAGGCAGAGCTGGG + Intergenic
1189824744 X:44906765-44906787 CAACACTGGGAGGCCGAGGTGGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190112637 X:47604261-47604283 AATAGGAGGGAGGCTGAGGTGGG + Intronic
1190265589 X:48825926-48825948 AATGAGAGGGCAGCAGAGGTGGG - Intergenic
1190567954 X:51750383-51750405 AATGACTGGGAGGCTGAGGTAGG - Intergenic
1190716036 X:53104471-53104493 CATGTTTGGGAGGCCGAGGCGGG - Intergenic
1190805636 X:53833629-53833651 CTTGGGAGGGAGGCTGAGGCAGG + Intergenic
1190928945 X:54932479-54932501 CTTGTGAGAGAGGCTGAGGTGGG + Intergenic
1191016318 X:55813627-55813649 CATGGAAGGGAGGCTGAGGGGGG + Intergenic
1192122773 X:68472828-68472850 CAGCACTGGGAGGCCGAGGTGGG + Intergenic
1192816676 X:74600910-74600932 CTTGGGAGGGAGGCTGAGGCAGG + Intronic
1194740523 X:97567866-97567888 GGTTGGAGGGAGGCCGAGGTGGG + Intronic
1195776157 X:108408202-108408224 CTCGGGAGGGAGGCTGAGGTGGG + Intronic
1196635308 X:117994934-117994956 CCTGTGAGGGACGCTGAGGTGGG + Intronic
1197796039 X:130299563-130299585 CACAAGAGGGAGGCCAAGATGGG - Intergenic
1198101500 X:133426155-133426177 CTTGGGAGGGAGACTGAGGTGGG - Intergenic
1198189445 X:134287909-134287931 CATGGGAGGGAGGCAGAGGGGGG + Intergenic
1200132783 X:153860263-153860285 CACTATCGGGAGGCCGAGGTGGG + Intergenic
1201165445 Y:11204634-11204656 CACAGGAGGGAGGCTGAGGTGGG + Intergenic
1201720336 Y:17089774-17089796 CATGAGAGGGATGCTCAGGAGGG + Intergenic