ID: 921706173

View in Genome Browser
Species Human (GRCh38)
Location 1:218324285-218324307
Sequence GAACCCGACGCTCTGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921706163_921706173 -2 Left 921706163 1:218324264-218324286 CCCTGCCAACCCCGCACAAATGA 0: 1
1: 2
2: 9
3: 12
4: 100
Right 921706173 1:218324285-218324307 GAACCCGACGCTCTGGGGGCTGG 0: 1
1: 0
2: 4
3: 16
4: 127
921706162_921706173 -1 Left 921706162 1:218324263-218324285 CCCCTGCCAACCCCGCACAAATG 0: 1
1: 0
2: 5
3: 25
4: 173
Right 921706173 1:218324285-218324307 GAACCCGACGCTCTGGGGGCTGG 0: 1
1: 0
2: 4
3: 16
4: 127
921706164_921706173 -3 Left 921706164 1:218324265-218324287 CCTGCCAACCCCGCACAAATGAA 0: 1
1: 3
2: 5
3: 9
4: 109
Right 921706173 1:218324285-218324307 GAACCCGACGCTCTGGGGGCTGG 0: 1
1: 0
2: 4
3: 16
4: 127
921706165_921706173 -7 Left 921706165 1:218324269-218324291 CCAACCCCGCACAAATGAACCCG 0: 1
1: 3
2: 10
3: 11
4: 57
Right 921706173 1:218324285-218324307 GAACCCGACGCTCTGGGGGCTGG 0: 1
1: 0
2: 4
3: 16
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921706173 Original CRISPR GAACCCGACGCTCTGGGGGC TGG Intronic
900272695 1:1800532-1800554 GTCCCCGAGGCTCAGGGGGCTGG - Intronic
901324610 1:8359082-8359104 GAGCCCGACCCTGTGGGGCCTGG - Intronic
902139999 1:14345328-14345350 GAATCAGAAACTCTGGGGGCAGG - Intergenic
914747391 1:150510225-150510247 GAAGCCCATGCTCTGGGGGAAGG - Intronic
915622433 1:157093975-157093997 GAGCCCAACTCTTTGGGGGCAGG + Intronic
919453819 1:197800678-197800700 GAACCCGACGCTCTCAGGGCTGG - Intergenic
921706173 1:218324285-218324307 GAACCCGACGCTCTGGGGGCTGG + Intronic
1063994991 10:11611219-11611241 GGACCCCACGCTCCGGGCGCGGG + Intronic
1069865482 10:71500322-71500344 AACCCAGAGGCTCTGGGGGCAGG - Intronic
1070695300 10:78558718-78558740 GAATCAGAAGCTCTGGGGGTGGG + Intergenic
1073248544 10:102107942-102107964 GAACTGGACTCTCTGGGGGCAGG - Exonic
1074264482 10:111887887-111887909 GAACCAGAAGCTCTGGGGGCAGG - Intergenic
1076549281 10:131267576-131267598 GAACCCGATGTTCCTGGGGCTGG + Intronic
1076653220 10:132004183-132004205 GAACACCAGGGTCTGGGGGCAGG + Intergenic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1078057481 11:8019498-8019520 GTACCCGAGGCTCTGGGTCCCGG - Intronic
1084041825 11:66546953-66546975 CAGCCCGAGGGTCTGGGGGCCGG + Intronic
1089295236 11:117463463-117463485 GAAGCAGAAGCTCTGGGGGTTGG + Intronic
1090639941 11:128721661-128721683 GAACCCAAACCTTTGGGGGCTGG + Intronic
1102203940 12:111077360-111077382 GAACCCTAGCCTCTGGGGACTGG + Intronic
1102591831 12:113962022-113962044 GAATCAGATGCTCTGGGGACGGG + Intronic
1103658249 12:122491998-122492020 GAACCCAAGGCTCTGAGGGTTGG - Intronic
1105240166 13:18600825-18600847 TAACCCGGCGCTCTGGGTGCGGG - Intergenic
1105420902 13:20251522-20251544 GAATCAGAAGCTCTGGGGGTGGG - Intergenic
1106506789 13:30377269-30377291 GAATCAGAAACTCTGGGGGCGGG + Intergenic
1110840016 13:80131381-80131403 GAATCCCACGCCCTGGGAGCAGG + Intergenic
1111925698 13:94461261-94461283 GAACCAGAAACTCTGGGAGCAGG + Intronic
1115798053 14:36961126-36961148 GAATCAGATGCTCTGGGGGTGGG - Intronic
1121475306 14:94195302-94195324 GAACCAGAATCTCTGGGGGTGGG + Intronic
1122778981 14:104135760-104135782 GACCCCGACTCCCTGAGGGCTGG - Intergenic
1123491065 15:20783260-20783282 TAACCCGGCGCTCTGGGTGCGGG + Intergenic
1123547567 15:21352351-21352373 TAACCCGGCGCTCTGGTTGCGGG + Intergenic
1125797445 15:42413335-42413357 GAACCTGATGATTTGGGGGCAGG + Exonic
1127738356 15:61869840-61869862 GAATCAGAAACTCTGGGGGCGGG + Intronic
1128149574 15:65354917-65354939 GAATCCGAAGCTCTGGCAGCAGG - Intronic
1128149828 15:65355858-65355880 GAATCCGAGGCTCTGGGGGAGGG - Intronic
1130651003 15:85762213-85762235 AAACCCGAACCTCTGGGGCCTGG + Intronic
1132041465 15:98527989-98528011 GAACACGCAGCTCTGGGGACTGG - Intergenic
1132085893 15:98907962-98907984 GAATCAGAAGCTCTGGGGGTGGG + Intronic
1202955897 15_KI270727v1_random:79581-79603 TAACCCGGCGCTCTGGTTGCGGG + Intergenic
1132841739 16:1981362-1981384 CAAGCCCACGATCTGGGGGCAGG + Exonic
1138660635 16:58515185-58515207 GAAGCCGAGGGTCTGGTGGCCGG - Intergenic
1141740560 16:85889291-85889313 GAAACTGAGGCTCGGGGGGCTGG - Intergenic
1141775217 16:86118509-86118531 GAATCAGAAGCTCTGGGGTCAGG - Intergenic
1144040706 17:11408373-11408395 GAATCAGAAGCTCTGGGGGTGGG + Intronic
1145217297 17:21061657-21061679 GAACCTGATGCTCTCAGGGCTGG + Intergenic
1149055364 17:52356845-52356867 AGACCCCACGCCCTGGGGGCAGG - Intergenic
1149501061 17:57152809-57152831 GAATCAGACACTCTGGGGGTGGG + Intergenic
1150286438 17:63956946-63956968 GAATCAGACACTCTGGGGGTGGG + Intronic
1151457399 17:74234137-74234159 GAAGCGGAACCTCTGGGGGCAGG - Intronic
1152560807 17:81077963-81077985 GAGCCGGACGCTGTGGGTGCAGG + Intronic
1152746771 17:82043967-82043989 GCACCAAAGGCTCTGGGGGCAGG - Intergenic
1153617392 18:6947436-6947458 GAAGCCGAGGCTCAGAGGGCAGG - Intronic
1154304124 18:13218186-13218208 GAACCGGACGCTTTGGGAACTGG + Intronic
1154448664 18:14457949-14457971 TAACCCGGCGCTCTGGGTGCGGG + Intergenic
1156206269 18:34889332-34889354 GAATCAGAAGCTCTGGGGGTTGG + Intronic
1156372873 18:36487257-36487279 GAACCTGACGCTCTGCTGGTGGG - Intronic
1156482788 18:37446551-37446573 TAACCCTACACACTGGGGGCTGG - Intronic
1157496291 18:48159872-48159894 GATCCAGAATCTCTGGGGGCTGG - Intronic
1159006496 18:63017547-63017569 GAAGCTGAGGCTCTGAGGGCTGG + Intergenic
1160832056 19:1108704-1108726 GACCCCGACGCTCTGCCCGCAGG - Exonic
1162379402 19:10322831-10322853 GAAACTGACACTCTGGGGCCGGG + Intronic
1163684167 19:18701205-18701227 GAGCCCCGGGCTCTGGGGGCGGG - Intronic
1166524767 19:43504147-43504169 GGACCAGAAGCTCCGGGGGCGGG + Intronic
1167005791 19:46775697-46775719 GAAGGTGACGCTCTGGGGGCAGG - Exonic
925911330 2:8575359-8575381 GGACCCGACGCTCAGGGTGAGGG - Intergenic
926784634 2:16507917-16507939 GAGACTGACGCTCTGGGCGCTGG + Intergenic
930025921 2:47029099-47029121 GAGCCCCAGGCACTGGGGGCAGG - Intronic
932338774 2:70946477-70946499 GAATCAGAAGCTCTGGGGGTAGG + Intronic
932492522 2:72131305-72131327 CAACCCTAGGCCCTGGGGGCTGG + Exonic
934709497 2:96505644-96505666 GAACCGGAGTCTTTGGGGGCGGG - Intronic
937079248 2:119128516-119128538 GAATCAGGCGCTCTGGGGGTTGG + Intergenic
939954472 2:148514913-148514935 GAACCCTTCGTTCTGGGGGTAGG + Intronic
941043453 2:160648401-160648423 GAACCTGACGCTCCTAGGGCCGG - Intergenic
944912936 2:204327984-204328006 GAATCGGAAACTCTGGGGGCGGG + Intergenic
945048157 2:205799897-205799919 GAATCAGAAGCTCTGGGGGTGGG + Intergenic
946456442 2:219830472-219830494 GAGCCAGAAGCTCTGGGGGTGGG - Intergenic
1171767334 20:29297462-29297484 GTGCCCCACGCTGTGGGGGCAGG - Intergenic
1172144073 20:32744013-32744035 GAATCAGATCCTCTGGGGGCGGG - Intergenic
1173913527 20:46689080-46689102 GGCCCCGAGGCTCTGGGGCCTGG - Intronic
1175143947 20:56881769-56881791 GAACCCGAGGCTCAGAGGCCAGG + Intergenic
1175182991 20:57161594-57161616 GAAGCCCAGGCTCTGGGGTCAGG - Intergenic
1175672820 20:60920645-60920667 GAGCTGGAGGCTCTGGGGGCTGG + Intergenic
1175960122 20:62631651-62631673 GAACCCGACACACTCGGGGCCGG + Intergenic
1176447564 21:6832569-6832591 TAACCCGGCGCTCTGGGTGCGGG - Intergenic
1176825733 21:13697595-13697617 TAACCCGGCGCTCTGGGTGCGGG - Intergenic
1179309989 21:40186718-40186740 GAGCTCAACGCTCTGGGTGCAGG + Intronic
1181150999 22:20883473-20883495 GAACCAGCCCCTCTGGGGACAGG - Exonic
1183081943 22:35462420-35462442 GAACCAGAGTCTGTGGGGGCAGG + Intergenic
950630146 3:14276784-14276806 GAACCCCACCCACTGGGAGCTGG + Intergenic
951498342 3:23355204-23355226 GAACCTCACACTCTGGGGACTGG + Intronic
953398355 3:42590711-42590733 GCCCCCGGCGTTCTGGGGGCTGG + Intronic
954188134 3:48935942-48935964 GAACCAGAGGCTCTAGGGGAAGG - Intronic
955063709 3:55516523-55516545 GAACCCAAAGGGCTGGGGGCTGG + Intronic
961310005 3:125990561-125990583 GAAGCGGAAGCTCGGGGGGCGGG + Intergenic
961356593 3:126343519-126343541 GAACCCGCGTCCCTGGGGGCTGG - Exonic
962710105 3:138079020-138079042 GAAGCAGAAACTCTGGGGGCAGG - Intronic
969612078 4:8232947-8232969 GAGCCAGAAGCTCTGGGGGCAGG + Intronic
972238098 4:37157674-37157696 GAACCAGGAGCTCTGAGGGCAGG - Intergenic
980415529 4:132483590-132483612 AAACACGAAGTTCTGGGGGCAGG + Intergenic
983238496 4:165206620-165206642 GAACCAGAAACTCTGGGGGTGGG - Intronic
989273487 5:39559098-39559120 GTACCTGGTGCTCTGGGGGCAGG + Intergenic
990411397 5:55544520-55544542 GAATCAGAATCTCTGGGGGCGGG - Intergenic
991064766 5:62413093-62413115 GAACCCGGGGAACTGGGGGCTGG + Intronic
996053009 5:118953112-118953134 GAATCAGAAGCTCTGAGGGCTGG - Intronic
999208453 5:149867485-149867507 CAACCAGAAGCTCTGGGGGTGGG - Intronic
1000232308 5:159327588-159327610 GAATCAGACACTCTGGGGGTGGG - Intronic
1002053974 5:176588018-176588040 GAACTCGAAGCTCTGTGTGCTGG + Intronic
1002435282 5:179227650-179227672 GAACCTGACGCTCATGGGGAGGG + Intronic
1004124935 6:12864257-12864279 GAACCCGACACTGTGGGGATGGG - Intronic
1004883380 6:20030395-20030417 GGAGCCGACTCTCTCGGGGCTGG + Intergenic
1007108100 6:39297012-39297034 AAAGCAGACGCTCTGGGGGCCGG - Intergenic
1016878703 6:148889125-148889147 GAATCAGACACTCTGGGGCCTGG - Intronic
1018173926 6:161163056-161163078 GAACCAGAGCCTCTGGGGACAGG + Intronic
1019474004 7:1235512-1235534 GAACCCGACGCTCTCCGTCCGGG + Intronic
1021696057 7:23277422-23277444 GAATTCGAAGCTCTGGGGGTGGG - Intergenic
1022965204 7:35465941-35465963 GAAGGTGAGGCTCTGGGGGCTGG + Intergenic
1028135572 7:87220136-87220158 GAACCCGCCGCCCTGCGGGAGGG - Intronic
1030110578 7:106023234-106023256 GAATCCGAAGCTCTGGAGGTGGG + Intronic
1032125496 7:129189613-129189635 GATCCCGAAACTTTGGGGGCAGG + Intronic
1035662539 8:1359021-1359043 GAATCCGAAGCTCTGGGGGCAGG - Intergenic
1039936440 8:42051152-42051174 GCACCCTAAGCTCTGGGGGCCGG + Intronic
1041111344 8:54485651-54485673 GAACCCAAGGCTCTTGGGCCAGG + Intergenic
1043377592 8:79667903-79667925 GAATCCAAAGCTCTGGAGGCAGG - Intergenic
1044941076 8:97344561-97344583 GAACCAGAATTTCTGGGGGCAGG - Intergenic
1045833802 8:106496264-106496286 GAACCAGAAACTCTGGGAGCAGG + Intronic
1046604626 8:116357411-116357433 GAACCAGAAGCTCTGGGGGCAGG - Intergenic
1049194378 8:141307725-141307747 GAAACCGAGGAACTGGGGGCGGG + Intronic
1049685493 8:143937673-143937695 GAGCCCGGCTTTCTGGGGGCTGG - Intronic
1050112563 9:2231975-2231997 GAATCAGAATCTCTGGGGGCGGG - Intergenic
1051402021 9:16693332-16693354 GAACCCAACCCTCTGGGGGTGGG + Intronic
1053315890 9:37051600-37051622 AAACCCTAATCTCTGGGGGCTGG + Intergenic
1057261717 9:93588176-93588198 TGACCAGATGCTCTGGGGGCAGG + Intronic
1058906671 9:109487508-109487530 GAATCACACGCTCTGGGGGTGGG + Intronic
1061092273 9:128433435-128433457 AAGCCCAACTCTCTGGGGGCGGG - Intronic
1061093258 9:128438971-128438993 AAGCCCGACTCTCTGGGGCCAGG - Intergenic
1061602076 9:131676916-131676938 GAAGCAGACACTCTGGGGGTAGG + Intronic
1061869087 9:133510787-133510809 GGACACGACGCCCTCGGGGCTGG + Intergenic
1062353277 9:136149352-136149374 GAACCCAACGCACTGAGGGGTGG - Intergenic
1203521627 Un_GL000213v1:51962-51984 TAACCCGGCGCTCTGGGTGCGGG + Intergenic
1187244651 X:17543110-17543132 GAATCAGAATCTCTGGGGGCAGG - Intronic
1190386495 X:49886833-49886855 GAACCAGAAACTCTGGGGGTGGG - Intergenic
1192440712 X:71171422-71171444 GAACCCAGCGCGCTGGGGGCAGG - Intergenic
1197730241 X:129803733-129803755 GATCCCAAACCTCTGGGGGCAGG - Exonic
1199683615 X:150244571-150244593 GAACCAGAAACTCTGGGGGCAGG + Intergenic
1199817263 X:151410015-151410037 GAATCGGACTCTCTGGGGGTGGG + Intergenic
1200210507 X:154344909-154344931 GTACCCGACACCCTGGGGGAGGG - Intergenic
1200220345 X:154387183-154387205 GTACCCGACACCCTGGGGGAGGG + Intergenic