ID: 921707862

View in Genome Browser
Species Human (GRCh38)
Location 1:218345158-218345180
Sequence CTGTGGGTAAGGGAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 933
Summary {0: 1, 1: 1, 2: 11, 3: 89, 4: 831}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921707862_921707878 24 Left 921707862 1:218345158-218345180 CCTCCTTCCTCCCTTACCCACAG 0: 1
1: 1
2: 11
3: 89
4: 831
Right 921707878 1:218345205-218345227 AACGGTTCGGGGAGAGCTCGTGG 0: 1
1: 0
2: 3
3: 6
4: 50
921707862_921707875 13 Left 921707862 1:218345158-218345180 CCTCCTTCCTCCCTTACCCACAG 0: 1
1: 1
2: 11
3: 89
4: 831
Right 921707875 1:218345194-218345216 CACACTCCCTCAACGGTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
921707862_921707874 12 Left 921707862 1:218345158-218345180 CCTCCTTCCTCCCTTACCCACAG 0: 1
1: 1
2: 11
3: 89
4: 831
Right 921707874 1:218345193-218345215 CCACACTCCCTCAACGGTTCGGG 0: 1
1: 0
2: 0
3: 2
4: 38
921707862_921707872 11 Left 921707862 1:218345158-218345180 CCTCCTTCCTCCCTTACCCACAG 0: 1
1: 1
2: 11
3: 89
4: 831
Right 921707872 1:218345192-218345214 TCCACACTCCCTCAACGGTTCGG 0: 1
1: 0
2: 0
3: 4
4: 64
921707862_921707871 6 Left 921707862 1:218345158-218345180 CCTCCTTCCTCCCTTACCCACAG 0: 1
1: 1
2: 11
3: 89
4: 831
Right 921707871 1:218345187-218345209 TCATTTCCACACTCCCTCAACGG 0: 1
1: 1
2: 1
3: 33
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921707862 Original CRISPR CTGTGGGTAAGGGAGGAAGG AGG (reversed) Intergenic
900131844 1:1090580-1090602 CTGTGGGCCTGGGAGCAAGGAGG + Intronic
900134474 1:1109367-1109389 CTGGGGGGCAGGGAGGAATGGGG + Intronic
900340202 1:2184899-2184921 CTGTGGGCAAAGGTGGCAGGGGG - Intronic
900356401 1:2266934-2266956 CTCTGCTTCAGGGAGGAAGGTGG + Intronic
900650747 1:3729053-3729075 CTGTTGGTAGGGGAGGAAGAGGG + Intronic
900941569 1:5801861-5801883 CTGGGGTTAGGGGAGGGAGGTGG + Intergenic
901026517 1:6281287-6281309 CTGTGGAGAAGGGAGGGCGGGGG + Intronic
901118439 1:6868633-6868655 GTGTGGGGCAGGGAGGGAGGGGG + Intronic
901972394 1:12918339-12918361 CTGTGGGTAAAGGAGAAGAGAGG - Intronic
902012785 1:13283423-13283445 CTGTGGGTAAAGGAGAAGAGAGG + Intronic
902622143 1:17656716-17656738 CTGGGGGGAATGGGGGAAGGGGG + Intronic
902919448 1:19657412-19657434 CTGTGGGAGGGGGAGGAAGTTGG + Exonic
903177129 1:21587849-21587871 CTATGGTCCAGGGAGGAAGGCGG + Intergenic
903210479 1:21815313-21815335 CTGTGTGTAAGTGTGCAAGGCGG - Intronic
903320701 1:22541528-22541550 CTGAGGCCAAGGGAGGAATGAGG - Intergenic
903643286 1:24875008-24875030 CTGTGGGTACGGGATGGAGGAGG - Intergenic
903693861 1:25193262-25193284 CTGGGGGCAAGGGAGGGAGGAGG + Intergenic
903774002 1:25781489-25781511 CTGTGGGAAGAGGAGGGAGGTGG - Intronic
904047733 1:27618764-27618786 CTTTGGGGAAGGGAGAAATGTGG - Intronic
904521489 1:31099502-31099524 CTGTGGGGAAGGCAGGGAGTAGG - Intergenic
904543517 1:31250176-31250198 CTGTGGAGAAGGGAGGGAGCTGG - Intergenic
904566756 1:31432944-31432966 CTGCAGGGGAGGGAGGAAGGTGG - Intronic
904827627 1:33284608-33284630 CTGGGGGTGAGGGTGGGAGGGGG - Intronic
904871020 1:33618291-33618313 CTTGGGGTAGGGGATGAAGGAGG - Intronic
905110372 1:35590348-35590370 ATGTGGTAAAGGGATGAAGGGGG + Intronic
905323138 1:37131797-37131819 AAGTGGGGAAGGAAGGAAGGGGG - Intergenic
905733774 1:40312819-40312841 CTGTGGGTCAGGGAGCAGGTTGG - Intronic
905966683 1:42104423-42104445 CAGTGGGCGAGGGAGGAAGAGGG - Intergenic
906097282 1:43232831-43232853 CTTTGGGTAAGTGATCAAGGAGG + Intronic
906677238 1:47701960-47701982 CTGGGGGTCAGGGAGGAGGTTGG - Intergenic
907446861 1:54513727-54513749 CTGCGGGGAAGGGCTGAAGGTGG + Intergenic
907559722 1:55377573-55377595 CTGTGGGTATGGGAGCTGGGAGG - Intergenic
908180212 1:61596496-61596518 CTGTGTGTAAGGGAGGTGGAGGG - Intergenic
908567925 1:65377804-65377826 CCATGGGAAAGGGAGGCAGGAGG - Intronic
908676550 1:66610978-66611000 CGGTGGGAAAGGGTGGGAGGGGG + Intronic
909352777 1:74673734-74673756 CTGTTGCTAAGGGAGGAGAGAGG + Exonic
909585144 1:77281529-77281551 CTGTGGGGAAGGGGGAAAAGGGG - Intergenic
910772526 1:90844377-90844399 CTATGGGGAGGGTAGGAAGGAGG - Intergenic
910957507 1:92722892-92722914 CAGTGGGTAAGGTAGAAAGCTGG - Intronic
911370430 1:96988923-96988945 CTGTGGGTGGAGGAGGGAGGAGG + Intergenic
911614518 1:99994446-99994468 CTGTGGGTAAGGGAGAATGGGGG - Intronic
912229260 1:107773621-107773643 CTGAGAATAAGGGAGGGAGGAGG + Intronic
912241815 1:107918503-107918525 CTGTGGGTAAATGATGAAAGAGG + Intronic
912255170 1:108050986-108051008 CTGTGGGGAATGGGGGATGGAGG + Intergenic
912655802 1:111485496-111485518 GTGTAGGTCAGGAAGGAAGGAGG - Intronic
912708855 1:111935369-111935391 CTGGGAGTAAGGGAAGCAGGTGG - Intronic
912956441 1:114156900-114156922 CTGGGGCAAAGGGAGGAGGGAGG + Intergenic
913092701 1:115490330-115490352 CTGTGTGTGAGGGAGGATGAAGG + Intergenic
913108862 1:115640618-115640640 CTGGGGGTGGGGGAGGAAGATGG + Intergenic
913252321 1:116922053-116922075 CTCTGGGGAAGGGAGGTTGGTGG + Intronic
913521207 1:119647590-119647612 CTGGGGCTAAGGGAGGGTGGGGG - Intronic
914695725 1:150077646-150077668 CTGTGGGTGAGAGAGAAAGATGG - Intronic
914872527 1:151487216-151487238 AGGGAGGTAAGGGAGGAAGGAGG - Intergenic
915144220 1:153785295-153785317 CTGTAGGAAAGGGAGGGATGCGG - Intergenic
915289594 1:154874308-154874330 CTGGGGCTTAAGGAGGAAGGTGG - Intergenic
915338202 1:155160333-155160355 GTGTGGGGAAGAGAGCAAGGAGG + Intergenic
915480048 1:156178270-156178292 CAGAGGGTAGAGGAGGAAGGTGG - Intergenic
915530136 1:156498599-156498621 CTGGGGGGAAGGGGGGGAGGGGG - Intronic
915581197 1:156814295-156814317 CTGTGGGTGACGGAGAGAGGGGG + Exonic
915589522 1:156862615-156862637 CTGCGGGTGAGTGAGGAGGGAGG - Intronic
915985785 1:160462790-160462812 CTGTTGCCAAGGGAGGAATGGGG - Intergenic
916064042 1:161121721-161121743 CTGTGAGTAAGGGAGCTATGTGG - Exonic
916272419 1:162957682-162957704 CAGTGGGCAAGGGAGGGAGCTGG - Intergenic
916399267 1:164428544-164428566 CTGGGGGATAGGGAGGAGGGAGG + Intergenic
916500878 1:165385766-165385788 ATGTGGAGAAGGGAAGAAGGGGG - Intergenic
916742383 1:167657602-167657624 CAGAGGGGAGGGGAGGAAGGAGG - Intronic
917250338 1:173052808-173052830 CAGTGGTTAAAGGCGGAAGGAGG - Intergenic
917518757 1:175730874-175730896 CTGTGGTTAGTGGAGGAATGAGG + Intronic
917598533 1:176553239-176553261 CGGTGGGTAAGGCAGGGAGGGGG + Intronic
917952854 1:180058548-180058570 TTCTGGGGAAGAGAGGAAGGAGG + Intronic
918217848 1:182408715-182408737 GGGTGGGTAAGGGTGGAGGGTGG - Intergenic
918362921 1:183777445-183777467 CTCTGGGGCAGGGATGAAGGAGG + Intronic
918473380 1:184898130-184898152 CTGTGAGCAAGGGAGGAGGGAGG - Intronic
918481813 1:184986184-184986206 CTGTGGTTAGGGAAGAAAGGAGG + Intergenic
918642691 1:186862453-186862475 CTTTGGGAAACTGAGGAAGGTGG - Intronic
919593922 1:199538175-199538197 CTGTGGGGCAGGGAGCAAGATGG - Intergenic
919737180 1:200959973-200959995 TTGTGGGGCAGGGAGGATGGGGG + Intergenic
919856974 1:201712674-201712696 CTTTGGGAAAGGGAGGAGGAAGG + Intronic
919925520 1:202189952-202189974 CTATGTGGAGGGGAGGAAGGAGG - Intergenic
919986073 1:202676168-202676190 GTGGGGGGAAGGGAGGAAGATGG - Intronic
920326620 1:205169968-205169990 GTGTTGGTAACCGAGGAAGGAGG - Intronic
921691677 1:218158094-218158116 CTGTAGGTAAGGTAGAAAGAAGG + Intergenic
921694379 1:218190777-218190799 TTTTGGGGAAGGGAGGAAGATGG + Intergenic
921707862 1:218345158-218345180 CTGTGGGTAAGGGAGGAAGGAGG - Intergenic
922367271 1:224877801-224877823 CTGGGGGAAAGGTAGGAGGGGGG + Intergenic
922466045 1:225846067-225846089 CTGTGGCTCTGGCAGGAAGGAGG - Exonic
922723229 1:227909649-227909671 GAGGGAGTAAGGGAGGAAGGAGG + Intergenic
923104602 1:230844371-230844393 CTGTGGCTCATGGTGGAAGGCGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923731113 1:236551169-236551191 CTGTGGGCAAGGAATGAAGGCGG - Exonic
1063375806 10:5553636-5553658 CTGTGGGGCTGGGAGGGAGGAGG - Intergenic
1063405262 10:5788388-5788410 CTGTGGGGGAAAGAGGAAGGAGG - Intronic
1063428246 10:5966103-5966125 GGGTGGGGGAGGGAGGAAGGTGG + Intronic
1063664150 10:8051721-8051743 CCGGGGGTAAGGGGGAAAGGTGG - Intergenic
1064225814 10:13483821-13483843 CTGGGGGTACGGGAGGAAGGGGG + Intronic
1064340518 10:14481429-14481451 TTGTGAGGAAGGAAGGAAGGAGG - Intergenic
1064704312 10:18056167-18056189 CTGAGGGGAAAGGAGGAAGTTGG + Intergenic
1065079494 10:22113476-22113498 TTGGGGGAAAGGGTGGAAGGGGG - Intergenic
1065667764 10:28081288-28081310 GTGTGGGTGAGGGAGGGAGCAGG - Intronic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1065968357 10:30786363-30786385 CTGTGGGTAGGGGATGAATCAGG + Intergenic
1066048598 10:31615916-31615938 CTGGGGGAAAGGTAGGCAGGTGG + Intergenic
1067597064 10:47566430-47566452 CGGTGGGTGGGGGAAGAAGGGGG - Intergenic
1067744173 10:48922674-48922696 CTGTGGGTAAGCGAGGACTGTGG + Intronic
1067771707 10:49131427-49131449 CTGTGCCTAGGGCAGGAAGGGGG + Exonic
1069777754 10:70936702-70936724 CTGGAGGTGAGGCAGGAAGGAGG - Intergenic
1069802583 10:71091242-71091264 CTGAGGGTGAGGAAGGAGGGTGG + Intergenic
1070483727 10:76910235-76910257 CTTTGGGTAAGGGGGGCAGTGGG + Intronic
1070574942 10:77670652-77670674 CGGAGGGGAAGAGAGGAAGGGGG + Intergenic
1071540115 10:86474618-86474640 CTTTGGGAGAGTGAGGAAGGAGG + Intronic
1072288645 10:93941559-93941581 GTGTGGGTGAGAGAGGAAGGGGG - Intronic
1072305590 10:94103726-94103748 GTGTGGGTAAGGATAGAAGGAGG - Intronic
1073053968 10:100687303-100687325 CTGTGTGCAAGAGAGGGAGGGGG - Intergenic
1073073105 10:100807281-100807303 CTGTGGGTGAGGGGAGCAGGTGG - Intronic
1073073129 10:100807383-100807405 CTGTGGGTGAGGGAGCAGGTGGG - Intronic
1073073164 10:100807536-100807558 CTGTGGGTGAGGGAGCAGGTGGG - Intronic
1073214090 10:101827105-101827127 CTGGGTGTCAGGCAGGAAGGGGG + Intronic
1073266487 10:102231102-102231124 CTGCGGGCACGGGAGAAAGGCGG + Intronic
1074161987 10:110843095-110843117 CTGAGGGCAAGAGAGGAAGGAGG + Intergenic
1074188355 10:111115680-111115702 CTGTGGGTTAGGGCTGGAGGGGG - Intergenic
1074284775 10:112088036-112088058 CTGTGGGAAAGGGAAGGACGTGG - Intergenic
1075185037 10:120248289-120248311 GTGGGGGTGAGGGAGGCAGGAGG - Intergenic
1075635229 10:124026131-124026153 CTGAGGGTAGGGGAGGACTGGGG + Intronic
1075879373 10:125837186-125837208 CTTTGGGTAGGGGAGAGAGGGGG + Intronic
1075936853 10:126350426-126350448 CTTTGAGAAAGGGAGGAAGAGGG + Intronic
1076024054 10:127098011-127098033 CTGGGGGTGAGGGACGAAAGTGG - Intronic
1076059951 10:127406079-127406101 CTTTAGGAAAGGGAGGCAGGTGG + Intronic
1076216506 10:128697986-128698008 CTGTGGGTGCGAGAGGAAGCAGG - Intergenic
1076461252 10:130649015-130649037 CTATTGGCAAGGGAGTAAGGAGG - Intergenic
1076915906 10:133423132-133423154 CCGTGGGCAAGGGAGGAAGGGGG + Exonic
1076936048 10:133567999-133568021 CTGTGGGCAAGGGAGGAAGGGGG + Intronic
1077025742 11:439158-439180 CTGTGGGACAGGAAGGATGGGGG - Intronic
1077147689 11:1053300-1053322 CTGTGGGAACTGCAGGAAGGAGG - Intergenic
1077238944 11:1500683-1500705 GTGTGGGTGAGGGACGTAGGGGG - Intronic
1077301609 11:1849826-1849848 CTGGGGGACCGGGAGGAAGGTGG + Intergenic
1078753376 11:14186310-14186332 AAGTGGGCAAGGGAAGAAGGAGG + Intronic
1079107499 11:17580916-17580938 CTGTGGTTGTGGGAGGAAGCAGG - Intronic
1079862603 11:25692835-25692857 CTGAGGGAAAGGGTGGAAGGGGG - Intergenic
1080822899 11:35824211-35824233 ATCTGGGTAAAGGAGAAAGGTGG - Intergenic
1081625824 11:44654536-44654558 AGGTGGGGAATGGAGGAAGGGGG - Intergenic
1083296174 11:61716850-61716872 GTGTGGGTGGGGGAAGAAGGAGG + Intronic
1083380610 11:62265312-62265334 CTGGGGGTCAGGTAGGAAGAAGG - Intergenic
1083417793 11:62536516-62536538 CTGAGGGGAAGAGAGGAAGGAGG - Exonic
1083493432 11:63030077-63030099 GTGTGGATATGGGAGGAAGCAGG + Intergenic
1083541645 11:63515679-63515701 CTGGGGGTAAAAGAGGAAGGGGG - Exonic
1083642002 11:64150671-64150693 CTTTGTGGGAGGGAGGAAGGGGG - Intronic
1083755831 11:64791224-64791246 TGATGGGTAAGGGAGAAAGGAGG - Intronic
1083802560 11:65054758-65054780 CTGTGTGTAAGGGAGGGACCGGG + Intronic
1084149090 11:67279822-67279844 GTATGGCTAAGGGAGGAAGCTGG - Exonic
1084333877 11:68445974-68445996 CTGTGTGTGATGGAGGGAGGAGG + Intronic
1084919556 11:72458127-72458149 GTGAGGGAGAGGGAGGAAGGAGG + Intergenic
1084937446 11:72594704-72594726 ATGTGAGCAAGGCAGGAAGGAGG - Intronic
1085044525 11:73345338-73345360 CCTTGGGGCAGGGAGGAAGGGGG - Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085300127 11:75453012-75453034 CGGTGGGTGGGGCAGGAAGGGGG + Intronic
1085403734 11:76249599-76249621 GTGGGGGTTAGGGAGGAAGGTGG - Intergenic
1085779351 11:79394282-79394304 CTGTGGGGATGTGAGGAGGGTGG + Intronic
1086064451 11:82731903-82731925 CTGTGGCTGAGGGAGGAGGCCGG - Exonic
1086249686 11:84798401-84798423 CTGTGGAAAAGAGAGGAAAGAGG - Intronic
1086497505 11:87419734-87419756 TTGTGGGTGTGGGAGGAAGGAGG - Intergenic
1086561804 11:88177007-88177029 CTGTGTGAAAGGGAGAAAGGAGG + Intergenic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088711856 11:112515808-112515830 CTGTGGGCAGGGGAGGGGGGTGG - Intergenic
1088923432 11:114278578-114278600 CTGTTGGTAGGGGTGGGAGGTGG + Intronic
1089009825 11:115123245-115123267 CTCTGGGGCAGGGAGGAGGGTGG - Intergenic
1089058936 11:115610237-115610259 CTGTGGGAAGGGGGGGAAAGGGG - Intergenic
1089213534 11:116821882-116821904 CTGTGGGGAAGGGCACAAGGAGG + Intronic
1089398297 11:118149975-118149997 CTGTGGAGAAGAGAGGAAAGGGG - Intronic
1089446879 11:118560167-118560189 CTTTGGGAAGGGGAGGCAGGAGG + Intronic
1089452362 11:118607451-118607473 CTGTGGGAAAGGGTGGGTGGGGG + Intronic
1089518966 11:119051347-119051369 CTGGGGGTGAGGGAGGATGTGGG - Intronic
1089579301 11:119471435-119471457 CTGGGAGTGAGGGAGGAAAGGGG - Intergenic
1089829100 11:121309409-121309431 CTGTGTGCCTGGGAGGAAGGGGG + Intergenic
1089835824 11:121369758-121369780 CTGTGGGCAAAGTATGAAGGAGG + Intergenic
1090231670 11:125111498-125111520 CTGCGGGGAAGGGAGAAAAGTGG - Intronic
1090239087 11:125169438-125169460 TGGTGGGAAAGGGAGGAAGGAGG + Intronic
1091102615 11:132889210-132889232 TTCTGGGCAAGGGAGGAAGTCGG + Intronic
1091200012 11:133771282-133771304 CGGTGAGTACAGGAGGAAGGTGG + Intergenic
1091307044 11:134542940-134542962 CTGTGGGTCAGAGGGTAAGGGGG + Intergenic
1091311761 11:134579907-134579929 CTGTGGGGAAGGGTGGCGGGAGG - Intergenic
1091600048 12:1912541-1912563 ATGAGGGTGAGGGAGGAATGAGG + Intronic
1091786454 12:3245886-3245908 CTGTGGCGCAGAGAGGAAGGTGG + Intronic
1091807514 12:3366600-3366622 ATGAGGGGAGGGGAGGAAGGGGG - Intergenic
1092108602 12:5943503-5943525 CAGCGGGTAAGGGTGGGAGGAGG + Intronic
1092282478 12:7108531-7108553 CTGTGGGTGTGGGAGGAGCGGGG + Intronic
1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG + Intergenic
1092511172 12:9158345-9158367 CAGGGGTGAAGGGAGGAAGGAGG - Intronic
1092651542 12:10640426-10640448 GTGTGGGTGAGGCAGGGAGGAGG + Intronic
1093467793 12:19467902-19467924 TTGTGGGCAAGGGAGGAATATGG + Intronic
1093559439 12:20520753-20520775 CTGTGGCAAAAGGAGGAATGGGG + Intronic
1093607472 12:21110297-21110319 GTGTGCGTATGGGAGGCAGGTGG - Intronic
1093952115 12:25174955-25174977 TTGTGGGGAAGAGTGGAAGGAGG + Intronic
1094189555 12:27683574-27683596 CTGGGGTTAAAGGAGGAGGGAGG + Intronic
1094721528 12:33069882-33069904 CGGTGGGTAAGGGTGGGAAGGGG - Intergenic
1095416236 12:41979744-41979766 CTGAGGGCAAGGGAGGAATGAGG + Intergenic
1095970829 12:47901093-47901115 TTGTGGGCAAGGGGGGTAGGTGG - Intronic
1096596701 12:52700443-52700465 CAGAAGGTGAGGGAGGAAGGTGG + Intronic
1096941737 12:55354800-55354822 GTGTTGGTAAGGGAGGCTGGTGG - Intergenic
1096994258 12:55829144-55829166 CTGTGTAGAAGGGACGAAGGTGG + Intronic
1097010704 12:55951800-55951822 CTGGGGAGAAGGGAGAAAGGGGG + Intronic
1097022310 12:56029012-56029034 CTGGTGGTGTGGGAGGAAGGAGG - Intronic
1097164023 12:57072535-57072557 CTTTGGGAAAAGGAGGGAGGAGG + Intronic
1097237844 12:57551825-57551847 GTGTGGGTAAGGGTGCAAGGTGG - Intronic
1097612435 12:61840781-61840803 CAGTGGGAAAGTGAGGATGGTGG + Intronic
1097805579 12:63961373-63961395 CTGGGGGTGAGGAAAGAAGGGGG - Intronic
1097998139 12:65912775-65912797 CTGTGGGCCAGAGAGGAAGAGGG - Intronic
1098200722 12:68052460-68052482 CAGTGGTAAAGGGAGAAAGGTGG + Intergenic
1098299183 12:69036713-69036735 CTCTGGTTGAAGGAGGAAGGAGG - Intergenic
1098865443 12:75757676-75757698 TTTTGGGTGAGGGAGGGAGGCGG + Intergenic
1100000347 12:89827190-89827212 TTGGGGGAAAGGGTGGAAGGGGG + Intergenic
1100402841 12:94247153-94247175 CTGTGGGAAACGGAGGGAGGAGG - Intronic
1100926499 12:99554440-99554462 TTGGGGGTAAAGGTGGAAGGTGG + Intronic
1101053866 12:100892576-100892598 ATCTGGGGAAGGGAGGGAGGTGG - Intronic
1101121007 12:101580082-101580104 TTGTGGGTAGGGGTGGGAGGAGG - Intronic
1101658730 12:106747544-106747566 CTGTGTGTGACGGAGGAAGAAGG - Exonic
1103058291 12:117838576-117838598 CTCAGGGGAAGGCAGGAAGGAGG - Intronic
1103238949 12:119397864-119397886 AAGTGGGGCAGGGAGGAAGGGGG + Intronic
1103238988 12:119397945-119397967 GTGTGGGAGGGGGAGGAAGGGGG + Intronic
1103239011 12:119397997-119398019 GTGGGGGGATGGGAGGAAGGGGG + Intronic
1103534953 12:121627624-121627646 CTGCGTGTGAGGGAGGAGGGAGG + Intronic
1103987887 12:124779703-124779725 CTCAGGGCAAGGGAGGCAGGGGG - Intronic
1104178115 12:126352055-126352077 CAGTGGGTCAGGGAAGAGGGAGG + Intergenic
1104343551 12:127975149-127975171 TTGAGGGAAAGGGTGGAAGGGGG - Intergenic
1104344991 12:127987915-127987937 CTCTGGATAAAGGAGGAATGAGG + Intergenic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104915431 12:132261982-132262004 CTGTGGGCAAGAGAGGTGGGAGG + Intronic
1105009560 12:132746433-132746455 CTGTGAGTTAGGGAAGGAGGAGG - Intronic
1105610496 13:21965074-21965096 CAGGGTGCAAGGGAGGAAGGTGG + Intergenic
1106243166 13:27925842-27925864 CTGGGGGTGAGGGAGAAAGATGG + Exonic
1106246273 13:27953460-27953482 GTGTGGGGCAGGGAGGAGGGTGG - Intergenic
1106302830 13:28485194-28485216 CTTTGGGGAAGGGAGAAAGGAGG - Intronic
1106306650 13:28517035-28517057 CTGGGGGAAAGGGTGGGAGGAGG + Intergenic
1106523139 13:30516016-30516038 CCGGGGGTGAGGGGGGAAGGTGG - Intronic
1106556761 13:30816580-30816602 CTGTGGCTAAGCGAGGAATCGGG - Intergenic
1106811791 13:33365212-33365234 CTGTGGGGAAGGGTGGGAAGAGG + Intergenic
1107445080 13:40463345-40463367 TTGTGGGGAAGGGTGGGAGGGGG - Intergenic
1107507595 13:41050165-41050187 CTGGGGGTAAGGGAGAAAGGGGG - Intronic
1107775080 13:43830279-43830301 TCTTGGGTAAGGGAGGAGGGAGG + Intronic
1109209176 13:59514840-59514862 ATGTGGGGCAGAGAGGAAGGAGG - Intergenic
1109327786 13:60890265-60890287 GTGGGGGTAAGGGAAGAAGTAGG + Intergenic
1109520321 13:63501909-63501931 CTGAGTGTAAGGTGGGAAGGTGG + Intergenic
1112146435 13:96705546-96705568 CTGAGTGCAAGGGAGGAAGAGGG - Intronic
1112365064 13:98749473-98749495 CTTTGGATAAGGGAGTGAGGTGG + Intronic
1113588002 13:111478821-111478843 CTGAGGGCAAGGGCAGAAGGGGG + Intergenic
1113791674 13:113032387-113032409 CTGTGGGGGAGGGAAGCAGGAGG - Intronic
1113974839 13:114219854-114219876 CTGTGTGTGAGGGAGGAAGGAGG + Intergenic
1114302580 14:21391682-21391704 CTTTGGGGGAGGGAGGGAGGGGG + Intronic
1114498840 14:23153380-23153402 CTGTGTATAATGAAGGAAGGCGG - Intronic
1114836588 14:26210339-26210361 GTGTGGGTAAAGGAGCAGGGGGG - Intergenic
1114929025 14:27444071-27444093 CTTTGGGAAGGGGAGGCAGGAGG - Intergenic
1115096703 14:29646244-29646266 GTGTGGGATGGGGAGGAAGGAGG + Intronic
1116561144 14:46380416-46380438 ATGTGTGTGAGAGAGGAAGGTGG + Intergenic
1117063153 14:51983214-51983236 CTGTTGTTAAGTGAGGAGGGAGG - Intergenic
1117826752 14:59712182-59712204 CTGAGGCTAAGGGAGGATTGTGG + Intronic
1117875291 14:60245763-60245785 ATGTAGGGGAGGGAGGAAGGAGG + Exonic
1118723846 14:68612847-68612869 GAGAGGGGAAGGGAGGAAGGGGG + Intronic
1118752096 14:68814967-68814989 CTGTGGGTGAGGCATGAACGGGG + Intergenic
1119163991 14:72477123-72477145 CTGTGGGAGCTGGAGGAAGGAGG + Intronic
1119444425 14:74651482-74651504 GTGTGTGTAAGGGAGGAGGGTGG + Intergenic
1119582192 14:75795572-75795594 TTGGGGGGAAGGGTGGAAGGAGG - Intronic
1119601884 14:75982255-75982277 CTGGGGGAAAGGGAGGGAGGGGG - Intronic
1119743341 14:77027886-77027908 CTGCGGGGGAGGGAGGAGGGGGG + Exonic
1120723296 14:87910742-87910764 CTGAGGGTAGAGGAGGGAGGAGG - Intronic
1121243518 14:92446948-92446970 CTGTGGGTGTGGGAGGAAAGGGG - Intronic
1121393911 14:93601248-93601270 TTGGGGGGAAGGGTGGAAGGGGG - Intronic
1121704882 14:95984038-95984060 CTGTAAGGAAAGGAGGAAGGAGG - Intergenic
1121719641 14:96100434-96100456 GTGTAGGTAAGGGAGAAGGGAGG - Intergenic
1121731574 14:96190996-96191018 CTGTGGGTAGGGGCAAAAGGAGG - Intergenic
1121777678 14:96601190-96601212 TTGGGGGGAAGGGTGGAAGGGGG - Intergenic
1122046990 14:99030750-99030772 GGGTGGGCAGGGGAGGAAGGAGG - Intergenic
1122371908 14:101233643-101233665 GTGTGGGTGAGGGCGGAAGGTGG - Intergenic
1122651691 14:103230071-103230093 CTATGGGGAGGGGAGGAGGGGGG + Intergenic
1122769813 14:104092958-104092980 CTGGGGGTGTGGGAGGAGGGTGG - Intronic
1122778784 14:104134936-104134958 CTGTGGGGGAGGGAGGAGGGTGG + Intergenic
1122811654 14:104292255-104292277 GTGTGGGTGGGGGAGGGAGGGGG + Intergenic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1123827826 15:24101309-24101331 GTGTGGGTCTGGGAGAAAGGAGG + Intergenic
1123827922 15:24101688-24101710 CAGGGAGTGAGGGAGGAAGGTGG + Intergenic
1123842381 15:24261099-24261121 CAGGGAGTGAGGGAGGAAGGTGG + Intergenic
1123857410 15:24427158-24427180 CAGGGAGTGAGGGAGGAAGGTGG + Intergenic
1123862041 15:24477690-24477712 CAGGGAGTGAGGGAGGAAGGTGG + Intergenic
1124058541 15:26265231-26265253 CAGCGGGTAAGGGAGGAGGAAGG - Intergenic
1125010999 15:34875063-34875085 CAGTGGGTGAGGGAGAATGGAGG + Intronic
1125085405 15:35723850-35723872 CTCTGGGTAAGGGTGGAAAGAGG + Intergenic
1125181891 15:36887849-36887871 CTGGGGGGAACGCAGGAAGGGGG - Intergenic
1125368855 15:38948294-38948316 TTGCGGGGAGGGGAGGAAGGAGG + Intergenic
1125433718 15:39624657-39624679 CTCAGTGTAAGAGAGGAAGGTGG - Intronic
1125597057 15:40894021-40894043 CTTTGGGTAAGGGAGAAGAGTGG + Intergenic
1125743322 15:41982660-41982682 CTGTGGGTAAATGAGGTTGGGGG - Exonic
1126399572 15:48255788-48255810 CTGTGGATAAAGGAGGAAATTGG - Intronic
1126413571 15:48395904-48395926 CTGTGAGTAAGGGAAGAGAGAGG + Intergenic
1126725213 15:51624285-51624307 CGCGGGGGAAGGGAGGAAGGGGG - Intergenic
1127610907 15:60635352-60635374 ATGTGGAGAAGGGAGAAAGGGGG + Intronic
1127773021 15:62245614-62245636 CTCTGGGGAAGGGAGGTGGGAGG - Intergenic
1128506452 15:68276493-68276515 CTTTGGGGAAGGGAGGAAGAGGG + Intergenic
1128622053 15:69159495-69159517 CTGTGGGTGAGGGAGTGAAGAGG + Intergenic
1128969001 15:72089534-72089556 CTCTGGGAAAGGAAGGGAGGAGG + Intronic
1129208404 15:74051061-74051083 CTGGGGCTAGGGGAGGAATGGGG + Intergenic
1129521551 15:76189579-76189601 CTGAGAGTCTGGGAGGAAGGGGG + Intronic
1129581478 15:76816055-76816077 CTCTGGGTAAGGGAGGGTGAGGG + Intronic
1129693088 15:77724756-77724778 CTGTGGCCAAGGGAGGTAGTAGG - Intronic
1129850349 15:78790160-78790182 CGGAGGTTAGGGGAGGAAGGTGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130667937 15:85885479-85885501 CTGTGGGTAAGAGTGTCAGGAGG + Intergenic
1130908714 15:88256883-88256905 GTGTGGGGAGGGGAGGGAGGGGG - Intergenic
1131382382 15:91974595-91974617 CTGTGGGCAGGGCAGGGAGGCGG + Intronic
1131934805 15:97491539-97491561 CTGGGGGTGAGGGAGGAGAGAGG + Intergenic
1132367899 15:101270894-101270916 CTTTTGGTAGGGGTGGAAGGAGG - Exonic
1132393332 15:101454607-101454629 CTGTGGGGGAGGGAGGAGTGGGG + Intronic
1132754388 16:1475396-1475418 CGGTGGGGAAGGGAGGAGGGAGG + Exonic
1132836087 16:1954149-1954171 CTGGGGGGCAGGAAGGAAGGAGG + Intronic
1132850067 16:2020903-2020925 CTTTGGCTAAGGGAGGGAGGGGG - Intergenic
1133300798 16:4781440-4781462 CTGTGGGGAAGGGAGAAATGGGG - Intronic
1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG + Intergenic
1133812787 16:9174113-9174135 CTGTTGGGAAGGGAGGCAGCTGG - Intergenic
1133901268 16:9977285-9977307 CTTGGAGCAAGGGAGGAAGGGGG + Intronic
1134024630 16:10944573-10944595 CTGTGGGCCGGGGAGGAAGGCGG + Exonic
1134600281 16:15528554-15528576 GTGTGTGTAAGGGAGGGAGCTGG - Intronic
1135040244 16:19112775-19112797 TTGTGGGGGAGGGGGGAAGGGGG + Intergenic
1135860510 16:26051752-26051774 GTGTGGGGTGGGGAGGAAGGAGG - Intronic
1135914572 16:26594069-26594091 CTGGGGGTGAGGGAGGGAAGGGG + Intergenic
1136367175 16:29814201-29814223 TGGCGGGTAAGGGAGGAAGGAGG - Intronic
1136399927 16:30011591-30011613 ACGTGGGGAAGGGAGGAGGGAGG - Intronic
1136568560 16:31083810-31083832 CTGTGGGGAAGGAAGGAGGGTGG + Exonic
1136776203 16:32873132-32873154 CTGCAGGCCAGGGAGGAAGGAGG - Intergenic
1136894412 16:33988380-33988402 CTGCAGGCCAGGGAGGAAGGAGG + Intergenic
1137298890 16:47126695-47126717 CTGATGGAAAGGGAGGCAGGAGG + Intronic
1137420133 16:48326326-48326348 CTGTGGGTTAGGGATGGAGGAGG - Intronic
1137580253 16:49629421-49629443 CTGTGGGTGTGGGTGGAAAGAGG - Intronic
1137613617 16:49834857-49834879 AAGTGGGTCAAGGAGGAAGGAGG + Intronic
1137913480 16:52403245-52403267 CTGTGGGGAAGGGGGCACGGCGG + Intergenic
1137929405 16:52572611-52572633 ATGTGGGTCAGGGAGAAAGAAGG + Intergenic
1138083745 16:54115539-54115561 CTGTGGGGAAGGGAGGTGGTTGG + Exonic
1138250518 16:55498443-55498465 CTGGAGGTAAGGGAGGGCGGTGG + Exonic
1138477081 16:57277741-57277763 CTGTGGTTAAGTGAGGATGTGGG + Intronic
1138494797 16:57401668-57401690 CTGTGATTAGGGGAGGAAAGCGG + Intergenic
1138503801 16:57466083-57466105 CTGGGGGTGAGGCTGGAAGGAGG - Intronic
1138562632 16:57810976-57810998 CCCTGGGTAAAGGAGGAGGGTGG + Intronic
1138594341 16:58021865-58021887 ATGTGGGTGAGGGATGAGGGTGG - Intergenic
1139359209 16:66387120-66387142 CTGGGGATGAGGGAGGGAGGAGG - Intronic
1139430803 16:66910211-66910233 CTGTGGCCAAGGCAGGGAGGGGG - Intronic
1139472676 16:67186694-67186716 CAGTGGGGAGGAGAGGAAGGAGG - Intronic
1139752131 16:69115296-69115318 CAATGGGTAAGGGAGGGAAGGGG + Exonic
1140144533 16:72293631-72293653 CTTTGGGAAAGGGAATAAGGTGG + Intergenic
1140598006 16:76438707-76438729 GTGTGGGTATGGGAGGGATGAGG - Intronic
1141219933 16:82059994-82060016 CTGAGGGCAAAGGAGGAGGGAGG + Intronic
1141429981 16:83966394-83966416 CTGGGGGGAAGGGAGGAAAGGGG + Intergenic
1141604383 16:85144574-85144596 CTGGGGGTAGGGAAGGGAGGAGG + Intergenic
1141732788 16:85833997-85834019 CTGTGTCAAAGGAAGGAAGGAGG + Intergenic
1141749709 16:85950138-85950160 CTGTGGGTGAGGGAGGAAGTAGG + Intergenic
1141823703 16:86464776-86464798 CTTTAGGGAAGTGAGGAAGGAGG - Intergenic
1142145179 16:88489924-88489946 TGGTGGGTGAGGGAGGGAGGGGG + Intronic
1142280953 16:89147287-89147309 GTGTGAGTGAGGGAGGAGGGAGG + Intronic
1142362112 16:89632386-89632408 CGGTGGCCAAGGGATGAAGGTGG - Intronic
1142368010 16:89660438-89660460 CAGAGGGTGGGGGAGGAAGGTGG + Intronic
1203078618 16_KI270728v1_random:1135241-1135263 CTGCAGGCCAGGGAGGAAGGAGG - Intergenic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1142685850 17:1576580-1576602 CTGTGGGTAAGAGGGGTCGGGGG - Exonic
1142880423 17:2879060-2879082 CAGTGGGTAGGGCAGGAAGGAGG - Intronic
1142900748 17:3009910-3009932 GTCTGGGGAAGGCAGGAAGGGGG + Intronic
1142992195 17:3739011-3739033 ATGAGGGAAGGGGAGGAAGGGGG - Intronic
1143046546 17:4085213-4085235 CAGTGGGGAAAGGAGGAAAGGGG + Intronic
1143254474 17:5545307-5545329 CTGTGTGTAAGAGAGACAGGGGG - Intronic
1143389634 17:6552634-6552656 CTATGGGTAGGGGTGGAAGGTGG - Intronic
1144062992 17:11599572-11599594 CTGAAGCTCAGGGAGGAAGGTGG + Intronic
1144750434 17:17644613-17644635 ATGTGGGGCAGGGAGGAAGTGGG + Intergenic
1145266900 17:21383998-21384020 CTGGGGGTGGGGGAGGCAGGGGG - Intronic
1145270363 17:21401527-21401549 CAGTTCATAAGGGAGGAAGGTGG + Intronic
1145308576 17:21688924-21688946 CAGTTCATAAGGGAGGAAGGTGG + Intergenic
1145781210 17:27564743-27564765 CTGTGGGTGGGGGAGGTGGGGGG - Intronic
1145941006 17:28743538-28743560 CTGCGGCCAAGGGAGGAATGTGG + Intergenic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1147170232 17:38614214-38614236 ATGTGTGTAAGGAAGGAAGGGGG - Intergenic
1147263452 17:39222073-39222095 CTGGAGCCAAGGGAGGAAGGAGG - Intronic
1147281564 17:39365903-39365925 CTAAGGGAAATGGAGGAAGGAGG - Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147426203 17:40346993-40347015 CTGCAGGTAAGGGGGGAGGGTGG + Intronic
1147647646 17:42043426-42043448 CTGTGTGTGGGGGAGGCAGGGGG - Intronic
1148810713 17:50289202-50289224 CTTTGGGAAGGTGAGGAAGGAGG - Intergenic
1148813945 17:50313247-50313269 CTGAGGGTAAGGGCAGGAGGCGG + Intergenic
1148846332 17:50532326-50532348 GTGTGGGAAAGGCAGGGAGGGGG + Intergenic
1149444313 17:56701781-56701803 GGGTGAGAAAGGGAGGAAGGAGG + Intergenic
1149510215 17:57234806-57234828 CTGTGGGGAAGGGACAGAGGTGG - Intergenic
1149570347 17:57667796-57667818 AGGTGGGTGAGGGAGGATGGTGG - Intronic
1149573997 17:57698315-57698337 AAGTGGGCAAGGGAGGGAGGAGG - Intergenic
1149868083 17:60161665-60161687 CGGAGGGAAAGGGAGGAGGGAGG - Intronic
1150089090 17:62305122-62305144 CTGGGGGGAAGGGTGGAAAGGGG - Intergenic
1150146938 17:62777103-62777125 CTGTGGGCAAGAGAAGAAAGGGG - Intronic
1150290691 17:63979778-63979800 CTTTGGGAAAGCGAGGGAGGAGG + Intergenic
1150628579 17:66859669-66859691 TTGGGGTGAAGGGAGGAAGGAGG - Intronic
1151379273 17:73713622-73713644 CTTTGGGAAACGGAGGAGGGAGG + Intergenic
1151408814 17:73907221-73907243 TAGTGGGCAAGGGAGGAGGGAGG + Intergenic
1151430106 17:74056480-74056502 CTGTGGGTAAGAGGAGAAGGAGG + Intergenic
1151565600 17:74895981-74896003 GAGTGGGAAAGGGAGGGAGGAGG - Intergenic
1151718609 17:75843759-75843781 CTCTGGGGAAGGGAGGGAGGTGG - Intronic
1151956774 17:77384070-77384092 CTGTCGAGCAGGGAGGAAGGCGG + Intronic
1152251827 17:79216431-79216453 CTGGGGGGCAGGCAGGAAGGAGG + Intronic
1152710122 17:81867226-81867248 CTGTGGCTGAGGCAGGAAGTAGG - Intergenic
1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG + Intergenic
1152911843 17:83009714-83009736 CTGGGTGCGAGGGAGGAAGGAGG + Intronic
1152926283 17:83089213-83089235 CAGTGGGTAGGGGTGGAGGGTGG - Intronic
1152982452 18:291237-291259 CTGGTGGTAAGTGAGGAAGCTGG + Intergenic
1153182575 18:2451753-2451775 CTGGGGGCAAAGGAGGATGGGGG + Intergenic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1153402982 18:4701566-4701588 TTGTGGGTAAGGGTGGGAGGGGG + Intergenic
1153683315 18:7521745-7521767 CTGGGGGTAGGGGAGGAACCGGG - Intergenic
1154338187 18:13482384-13482406 CTGTGGGGAAGGTGGGACGGTGG - Intronic
1155208392 18:23580286-23580308 CTGGGGGTAGGGGAGGCAGGAGG - Intronic
1156108271 18:33691969-33691991 CTGAGGGTCAGGGAGGAAAAAGG + Intronic
1156302828 18:35850264-35850286 CGGTTGGTAAAGGAAGAAGGGGG - Intergenic
1156454717 18:37286549-37286571 CTGTGGGTCAGAGGGGCAGGGGG - Intronic
1156513355 18:37660028-37660050 CAGTGGGGGAGGGAGGGAGGAGG + Intergenic
1157160387 18:45308651-45308673 CTGAGAGGAAGGGAGGGAGGCGG - Intronic
1157374586 18:47151032-47151054 CAGCGGGTTAGGGAGGGAGGTGG - Intronic
1157464825 18:47934034-47934056 CTGGGGAAAAGGGAGCAAGGTGG - Intergenic
1158172114 18:54611833-54611855 TTGGGGGGAAGGGAGGGAGGGGG + Intergenic
1158331176 18:56364495-56364517 CTGTGGGGAAGAGTGGAAGTGGG - Intergenic
1158395510 18:57076199-57076221 CTCTGGGGAAGGCAGCAAGGTGG + Intergenic
1158672706 18:59491318-59491340 CTGTGAGGAAGGGAAAAAGGTGG - Intronic
1158733050 18:60046922-60046944 CTGTGAGTAAGTGAAGAAGATGG + Intergenic
1158866119 18:61639055-61639077 TTGTGGGAAGGGGAGGAAAGGGG + Intergenic
1158876995 18:61743290-61743312 CTGTCTGTAAGGGAGGAAGGAGG - Intergenic
1158898397 18:61937383-61937405 CTCTGGGAAAGGGATTAAGGTGG + Intergenic
1160321878 18:77904151-77904173 CTGTGGGTAAGGTAGGAGTTTGG - Intergenic
1160338292 18:78062669-78062691 CCCTGGGGAAAGGAGGAAGGTGG + Intergenic
1160594032 18:79962083-79962105 CTTTCTGGAAGGGAGGAAGGAGG + Intergenic
1160825373 19:1077834-1077856 CTGTGGGTGTGGGAGCCAGGAGG - Intronic
1160907834 19:1460098-1460120 CTCTGGGCAAGGGAGTGAGGTGG + Intronic
1161012571 19:1967728-1967750 CTGGGGAGGAGGGAGGAAGGAGG - Intronic
1161012592 19:1967789-1967811 CTGGGGAGGAGGGAGGAAGGAGG - Intronic
1161012613 19:1967850-1967872 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161012634 19:1967911-1967933 CTGGGGAGAAGGGAGGAGGGAGG - Intronic
1161150725 19:2707245-2707267 GTTTGGGGATGGGAGGAAGGTGG - Intergenic
1161366256 19:3881428-3881450 CTGTGGGGTGGGGAGGAAGGGGG + Intronic
1161422640 19:4184302-4184324 CAGGAGGTAGGGGAGGAAGGAGG + Intronic
1162153564 19:8661954-8661976 CTTTGGGAAACTGAGGAAGGAGG + Intergenic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1163122347 19:15225613-15225635 CTGGGGATAAGGGAGGACAGAGG + Intergenic
1164231919 19:23296888-23296910 CTGAGGATGATGGAGGAAGGGGG + Intergenic
1164452956 19:28382417-28382439 GTGTGGGGAAGGAAGGGAGGTGG - Intergenic
1164469663 19:28519363-28519385 CTGGGGGTCAGGGCGGGAGGGGG + Intergenic
1166026325 19:40089003-40089025 ATGTGGGTGAGGGAGGAAGGAGG + Intronic
1166107289 19:40603729-40603751 CTGTGCGGAGGGGAGGGAGGAGG - Intronic
1166137039 19:40783898-40783920 CTGTGGAGAAGGGAGAAGGGAGG - Intronic
1166326674 19:42055013-42055035 CTGAGGTTCAGGGAGGAATGAGG - Intronic
1166338437 19:42122670-42122692 CTGGGGGTAAGGGGGGAATTTGG - Intronic
1166361734 19:42255319-42255341 CGGCGGGGGAGGGAGGAAGGAGG + Intergenic
1166651939 19:44581427-44581449 CGGGGAGTAAGGGAGGAAGCGGG - Intergenic
1166756510 19:45195598-45195620 CTCTGAGGAAGGAAGGAAGGAGG - Intronic
1166893806 19:46010557-46010579 CTGTGGGAGAGGGAGGCAGGAGG + Intronic
1167036359 19:46997401-46997423 CTGTGGGGAAGGGAGGCCGCAGG - Intronic
1167209441 19:48123974-48123996 GTGTGTGTCAGAGAGGAAGGAGG + Intronic
1167346788 19:48950911-48950933 CTGTGGGAAACTGAGGCAGGTGG + Intergenic
1167555979 19:50196002-50196024 ATGTGGGTGAGGGATGAAGTGGG - Intronic
1167575822 19:50317023-50317045 CTATGGGTGAGGGAGGATTGGGG - Intronic
1167577598 19:50325301-50325323 CTGCGGGTAGTGGAGGAGGGAGG + Intronic
1168239944 19:55083882-55083904 CTGGGCCTAAGGGAGGAAGGGGG + Intronic
924992417 2:323669-323691 CTGAGGGAAAGGGTGGGAGGGGG - Intergenic
924994349 2:343216-343238 GTGTTGGTAAAGGAGGAAGAAGG + Intergenic
925067257 2:938149-938171 CTCTGGGTAAGGGAGAGAGTGGG - Intergenic
925166540 2:1719234-1719256 CTGTGGCTGAGGGGTGAAGGTGG - Intronic
925194667 2:1913447-1913469 CTCTGGGACAGGGAGGAAGGGGG - Intronic
925515319 2:4674868-4674890 ATGGGGGTAGGGGAGGACGGGGG - Intergenic
925580883 2:5409261-5409283 CGGTGGGGGAGAGAGGAAGGGGG + Intergenic
926809205 2:16741390-16741412 CGGTGTGGAAGGTAGGAAGGTGG - Intergenic
927678452 2:25123992-25124014 CTGTGGGTGAGAGAGGGTGGAGG + Intronic
927702101 2:25275362-25275384 CTGTGGGAAGGAGAGGAAGTGGG - Intronic
927808559 2:26169411-26169433 CTGGGGGAAAGAGAGGGAGGAGG - Intergenic
927896160 2:26783808-26783830 CAGTGAGTAAGGGAGGAATGGGG - Intronic
929447374 2:42011805-42011827 TTGTGATTTAGGGAGGAAGGTGG + Intergenic
929713858 2:44291636-44291658 CTGGGGGTAAGGTGGGGAGGAGG - Intronic
929950297 2:46405128-46405150 CTGGGGATAAGGATGGAAGGAGG - Intergenic
930804214 2:55473919-55473941 CTGTGGGTAGAGGAGGAAGGGGG + Intergenic
930806073 2:55492058-55492080 CTGTGAGGAAGTAAGGAAGGTGG + Intergenic
931656209 2:64512175-64512197 CTGTCCGTGAGGGAGGAGGGAGG - Intergenic
931854432 2:66287239-66287261 CTGGGGGATAGGGAGAAAGGGGG - Intergenic
931991054 2:67790851-67790873 CTGTGAGTTAGGGAGGAAGCTGG - Intergenic
932172842 2:69573146-69573168 ATGTGGGCTGGGGAGGAAGGTGG + Intronic
932221134 2:69999887-69999909 GGGTGGGAGAGGGAGGAAGGAGG - Intergenic
932309653 2:70729301-70729323 CTGAGGCAGAGGGAGGAAGGAGG - Intronic
932385189 2:71325807-71325829 GAGTGGGTGAGGGAAGAAGGTGG + Intronic
932479731 2:72031991-72032013 CTGTGGGTAACAGGAGAAGGAGG - Intergenic
932734088 2:74242185-74242207 CTGGGGCAAAGTGAGGAAGGTGG - Intronic
932751138 2:74372397-74372419 CTGTGGGGCAGGGGAGAAGGTGG + Intronic
932794495 2:74682705-74682727 CTTTGGGGGAGGGAGGAAGGTGG + Intronic
933628878 2:84633828-84633850 TTGTGGGAATCGGAGGAAGGGGG + Intronic
934578720 2:95420759-95420781 CTATGGGAAAGGAAGGAATGGGG + Intergenic
934600725 2:95655950-95655972 CTGTGAGAAAGGAAGGAATGGGG - Intergenic
934859454 2:97751795-97751817 CGGTGAGAAAGGGAGGAAGAGGG + Intergenic
934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG + Intronic
935319144 2:101868649-101868671 ATGTGGGTAAGGCTTGAAGGAGG + Intronic
935640757 2:105287811-105287833 CTGTGAGTAATGGAGGGAGGTGG + Intronic
935813816 2:106827536-106827558 CTGTGGGTAAGGGTTGGGGGTGG - Intronic
936487388 2:112937963-112937985 GAGTGGGTGATGGAGGAAGGAGG + Intergenic
936534096 2:113298090-113298112 CTGTGGGAAAGGAAGGAATGGGG - Intergenic
937176569 2:119942482-119942504 CTGTGGGAAAGGGAGTAAGGTGG - Intronic
937227164 2:120376503-120376525 CAGAGGAGAAGGGAGGAAGGAGG - Intergenic
937751669 2:125482774-125482796 TTGTGGGAAAGGGTGGGAGGGGG - Intergenic
937821599 2:126316681-126316703 TTGTGGGGAAGGAAGGAAGGAGG - Intergenic
938273681 2:129997307-129997329 ATGTGAGAAAGGAAGGAAGGGGG + Intergenic
938707029 2:133940742-133940764 CTGAGGGTAAGTGAAGAAGGTGG + Intergenic
939134453 2:138276804-138276826 CTTTGTGTAAGAGAGGAAAGAGG - Intergenic
939354314 2:141081447-141081469 AAGTGCGTAAGAGAGGAAGGAGG - Intronic
939979394 2:148760133-148760155 CTGAGGCTGAGGGAGGAGGGAGG + Intronic
941099242 2:161278824-161278846 CTGTGGGTAAGGCTGCAATGTGG - Intergenic
941466068 2:165828675-165828697 CTTTGGGAAGGTGAGGAAGGAGG - Intergenic
942116582 2:172735230-172735252 CTGAGGGGCAGGGAGGGAGGAGG - Intergenic
942384745 2:175430495-175430517 TTGTGAGACAGGGAGGAAGGGGG + Intergenic
942509935 2:176687170-176687192 CTATGGGTAAAGGGGGCAGGAGG - Intergenic
943449035 2:188025352-188025374 TTGGGGGTAAGGGTGGGAGGTGG - Intergenic
943683424 2:190791812-190791834 CAGTGGGAAAGGAAGGACGGGGG - Intergenic
943752671 2:191525934-191525956 TTGGGGGCAAGGGTGGAAGGGGG + Intergenic
943834659 2:192503626-192503648 CTGGAGATAAGGGAGGAAGAAGG + Intergenic
944554680 2:200875915-200875937 CTGTGTATCAGGGAGGAAAGGGG - Intronic
945136004 2:206628014-206628036 CTGTGGGTAAGAGAGGCAAGAGG + Intergenic
945540608 2:211081807-211081829 CTGTGGGTTAAGGGGAAAGGAGG - Intergenic
945789424 2:214286166-214286188 CTGTGGTGAACGGAGTAAGGGGG + Intronic
946016325 2:216606858-216606880 CTGTGAGGAAGGAAGGCAGGTGG - Intergenic
946037250 2:216754086-216754108 CTCTAGGTCAGGAAGGAAGGGGG - Intergenic
946066248 2:216989832-216989854 TTGAGGGGAAGGGAGGAAAGTGG + Intergenic
946276083 2:218632905-218632927 CTATGGGGAAGGGAGGCAGAGGG + Intronic
946325136 2:218981150-218981172 GTGTGGGGACAGGAGGAAGGGGG + Exonic
947271613 2:228342713-228342735 GTGAGGATAAGGGAGGGAGGGGG + Intergenic
948022079 2:234742312-234742334 CTGTGGTGCAGGGAGGCAGGAGG + Intergenic
948059919 2:235035142-235035164 CTGTGGCTAAGGGAGAACGTTGG + Intronic
948230772 2:236347699-236347721 CTGTGGGGAAGAGTGGGAGGGGG + Intronic
948523641 2:238557683-238557705 CTCTGGGTCAGGCAGGAAAGTGG + Intergenic
948650335 2:239439812-239439834 CGGGGTGAAAGGGAGGAAGGAGG + Intergenic
948685304 2:239666167-239666189 CTATGGGGAAGGGAGTGAGGTGG + Intergenic
948831488 2:240600533-240600555 CTGTGGGTGAGTCAGGAGGGTGG - Intronic
948869256 2:240790087-240790109 CTGGGGGCAAGGATGGAAGGTGG - Intronic
948874031 2:240818035-240818057 CAGTGGGGAAGGGGGAAAGGAGG + Intronic
1168949368 20:1786158-1786180 AGGTGGGTAAGGAAGGAAGCAGG + Intergenic
1169074278 20:2751828-2751850 CTGTGGGCAAGGGGGTGAGGAGG + Intronic
1169193129 20:3670178-3670200 CTGTGGGCAGAGGAGCAAGGTGG - Intronic
1170455922 20:16532637-16532659 CTGTGGGAATGGGAGGAATCTGG - Intronic
1170646166 20:18197726-18197748 CTCTGGGAAGGGGAGGAAAGCGG - Intergenic
1170808798 20:19657374-19657396 CTGTGGGTGAGGGAAGATGTTGG - Intronic
1171510842 20:25683354-25683376 CTGGGGGAAATGGGGGAAGGAGG + Intronic
1171979785 20:31619532-31619554 CTGTGGGTCAGGGATTAAAGTGG - Intergenic
1172189962 20:33056021-33056043 CTGTGGGAAGGGCAGGATGGAGG - Intronic
1172320705 20:33993619-33993641 CGGCGGGGACGGGAGGAAGGCGG - Intergenic
1172578810 20:36030732-36030754 CTGTGGGACTTGGAGGAAGGGGG + Intergenic
1172750277 20:37245905-37245927 AGGTGGGTCTGGGAGGAAGGAGG + Intergenic
1172820473 20:37728838-37728860 CTGTGTGTGAGGGAGGAGGTTGG + Intronic
1173009356 20:39167780-39167802 CAGTGGGTTAGGGAGGAGGTAGG - Intergenic
1173086597 20:39925208-39925230 CTGTGGGAGAGAGAGGAAGGTGG + Intergenic
1173222029 20:41138412-41138434 CTGGGGGAGAGGGAGGAAGGTGG + Intronic
1173249500 20:41357204-41357226 CTGTGGGAAGGGGAGGGAGAGGG + Intronic
1173309663 20:41886078-41886100 TTGGGGGGAAGGGAGGGAGGGGG + Intergenic
1173522680 20:43711373-43711395 TCCTGGGTAAGGCAGGAAGGAGG - Intronic
1173603072 20:44309935-44309957 GGGTGGGTGAGGAAGGAAGGTGG + Intronic
1173818950 20:46008597-46008619 CTGTATGAAAGGGAGGGAGGGGG - Intergenic
1173956332 20:47035762-47035784 CTTTGGGAAACGGAGGCAGGAGG + Intronic
1174022186 20:47539613-47539635 ATGGGTGTGAGGGAGGAAGGAGG + Intronic
1174805487 20:53601264-53601286 ATGTGGGGAAGGGAGGACAGTGG - Intronic
1175113339 20:56664465-56664487 CTGTGGGTAAGAGTGGAAGCCGG + Intergenic
1175231195 20:57474415-57474437 ATGTGGAAAAGGGAGGTAGGAGG + Intergenic
1175348718 20:58302481-58302503 CTGTGTGTGAGGGAGGGAGTGGG - Intergenic
1175412252 20:58777917-58777939 CTGTGGGGAAGGGTGGAGGCTGG - Intergenic
1175518961 20:59587558-59587580 CTGTGGGTCAGGGGTGCAGGTGG + Intronic
1175625518 20:60485552-60485574 CTTGGGGGAAGGCAGGAAGGAGG - Intergenic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1175700365 20:61132494-61132516 CTCAGGGAAAGGGAGGGAGGGGG - Intergenic
1176206313 20:63890336-63890358 CTGTGAGTCAGGGAAGGAGGAGG - Exonic
1176424239 21:6538173-6538195 CTGTGGGTGAGGCAGGAGTGTGG + Intergenic
1176954921 21:15091193-15091215 CAGGGGGGAAGGTAGGAAGGTGG + Intergenic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1178493266 21:33067719-33067741 CTGTGTGCAGGGGAGGAAGCCGG + Intergenic
1178534086 21:33398288-33398310 CTGTGGGTATGGCAGGAGTGGGG + Intergenic
1178701412 21:34836335-34836357 CTGAGGGAAAGGGATGATGGGGG - Intronic
1178812303 21:35895388-35895410 CTGGGGGAAAGGGTGGGAGGGGG + Intronic
1179050999 21:37888578-37888600 CCATGGGGATGGGAGGAAGGTGG + Intronic
1179505285 21:41835911-41835933 CTGTGGGGGAGGGAGGAGAGTGG - Intronic
1179505296 21:41835941-41835963 CTGTGGGGGAGGGAGGAGAGCGG - Intronic
1179505309 21:41835971-41835993 CTGTGGGGGAGGGAGGAGAGTGG - Intronic
1179699732 21:43146488-43146510 CTGTGGGTGAGGCAGGAGTGTGG + Intergenic
1179812015 21:43877886-43877908 GTGTGGGAGATGGAGGAAGGGGG - Intronic
1182478408 22:30589841-30589863 TGATGGGTGAGGGAGGAAGGGGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182819874 22:33206440-33206462 CTGTAGGTAAGTAAGGCAGGAGG - Intronic
1183251240 22:36731902-36731924 GTGTTGGGAAGGGATGAAGGTGG - Intergenic
1183408337 22:37641041-37641063 CTGCGGGGAAGGGAAGTAGGGGG + Intronic
1183418619 22:37697298-37697320 TTGTGGGTAGGGGAGGAAACGGG + Intronic
1183667493 22:39254036-39254058 CTTGCGGGAAGGGAGGAAGGGGG + Intergenic
1183694185 22:39411128-39411150 TTCTGTGTAAGGTAGGAAGGAGG - Intronic
1183717670 22:39543361-39543383 CTTTGGGTCGGGGAGGCAGGGGG - Intergenic
1183730919 22:39617874-39617896 CTGAGGGGGAGGGAGGAAAGAGG - Intronic
1183799905 22:40153728-40153750 TTGTGAGGAAGGGAGGATGGAGG + Intronic
1183813553 22:40278982-40279004 CTTTGGGAAGGCGAGGAAGGTGG - Intronic
1184080288 22:42214553-42214575 CTGTGGTGAAGGGAAGGAGGAGG + Exonic
1184247866 22:43244826-43244848 CTGAGGGGCAGGGAGGAAGAAGG - Intronic
1184430597 22:44439783-44439805 TAGGGGGTGAGGGAGGAAGGAGG - Intergenic
1184482350 22:44755243-44755265 CAGTGTGTGTGGGAGGAAGGTGG - Intronic
1184981929 22:48101185-48101207 CTGTGGGAAAGGGATGTGGGCGG + Intergenic
1185105893 22:48869598-48869620 CTGGGGGCCAGGGTGGAAGGTGG - Intergenic
1185110134 22:48896202-48896224 GTGAGGGTGAGGGAGGAGGGAGG + Intergenic
1185176905 22:49333025-49333047 CTGGGGGCAAGGGAGGAGGCAGG + Intergenic
1185341519 22:50293362-50293384 CTGTGGGTAGGGGAGGGGCGCGG - Intronic
949315746 3:2752757-2752779 AGGTGGGGAAGGGAGGAAGAAGG - Intronic
949840125 3:8311300-8311322 CTGTGGGATAGTGAAGAAGGAGG - Intergenic
950075953 3:10187393-10187415 CTCTGGGTCAGACAGGAAGGCGG + Intronic
950273422 3:11638539-11638561 GTGGGGGTTAGGGAGGAAGGGGG - Intronic
950469608 3:13176412-13176434 CTAGGGGTAAGGGTGGAAGAAGG - Intergenic
950588444 3:13915330-13915352 CTTGGGGGAAGGGTGGAAGGTGG + Intergenic
950895850 3:16450167-16450189 TTGTGGGTTAGGAAGGAAAGTGG - Intronic
950967059 3:17153937-17153959 CTGAGGGGAAGGCAGGTAGGTGG - Intergenic
951668118 3:25149643-25149665 CTGTGGGTATGGGAGGTGAGTGG - Intergenic
951753278 3:26060775-26060797 CTGTGGGAAAGGGAAGAAAGAGG + Intergenic
953071228 3:39521961-39521983 GAGTGGGTATGGGAGGAGGGTGG + Intronic
953181317 3:40597602-40597624 CAGTGGGGAAGGGAGGCAAGAGG + Intergenic
953563465 3:44012497-44012519 GTGTGGGTGAGGGAGGGAAGAGG - Intergenic
953891552 3:46755296-46755318 AGGTGGGTGAGGGAGGAGGGTGG - Intronic
954150016 3:48652654-48652676 CTGTGGGTCCAGGAGGGAGGGGG - Intronic
954215074 3:49120244-49120266 AAGTGTGTAAAGGAGGAAGGAGG + Intronic
954436222 3:50497761-50497783 CTGTGGCTAAGGGCAGAAGGGGG - Intronic
954512059 3:51133924-51133946 CTGAGGGTGAGGGTGGGAGGAGG - Intronic
955021565 3:55126635-55126657 TAGTGGGGAAGGGAGGAAGAAGG + Intergenic
955219436 3:57011560-57011582 CTGTGGGTGGCGGGGGAAGGTGG - Intronic
955426526 3:58796472-58796494 CTGTGGATCGGGGAGGAAAGAGG + Intronic
956437411 3:69247281-69247303 CTGGGGCTAAGTGGGGAAGGTGG + Intronic
956507570 3:69958998-69959020 TTGCGGGGAAGGGAGGGAGGGGG + Intronic
957575167 3:81997862-81997884 ATGTGAGTAAGGGAAGAAGACGG + Intergenic
958045919 3:88283422-88283444 CTGTGTGTGAATGAGGAAGGAGG + Intergenic
958513929 3:95088135-95088157 CTGAGGGTGAGAAAGGAAGGAGG - Intergenic
958795374 3:98701516-98701538 GTGTGGAAAAGGGAGGAAGAAGG + Intergenic
958962604 3:100524173-100524195 CTGTGAGTGCGGGAGGATGGTGG + Intronic
960769786 3:121180956-121180978 CAGAGGGTAAGGGAGGGAAGGGG + Intronic
960987926 3:123292532-123292554 CTGTGGGTGGTGGTGGAAGGCGG - Intronic
961175074 3:124828496-124828518 CCTGGGGTAAGGGAGGCAGGAGG + Intronic
962337664 3:134550873-134550895 CAGTGGGCAAGGGAGGCAGAGGG + Intronic
962498346 3:135965553-135965575 CTCTGGCCAAGGCAGGAAGGGGG - Intergenic
962744554 3:138387883-138387905 CTGTGGGGAATGGAGTGAGGGGG - Intronic
962936015 3:140081597-140081619 GTGGGGGTAAGGGTGGGAGGAGG - Intronic
963049876 3:141132127-141132149 CTGGGGGAAAGGGTGGGAGGGGG - Intronic
964791318 3:160454776-160454798 CTTTGGGAAACGGAGGCAGGCGG + Intronic
966534037 3:181011095-181011117 CTTTGTGTGAGAGAGGAAGGAGG - Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
967054754 3:185822835-185822857 CTGGGGGTAGGGGCGGGAGGTGG + Intronic
967168505 3:186805573-186805595 CTGTGGGGAAGGGAAGGTGGGGG + Intronic
968161699 3:196432217-196432239 CTGTGGGTAAAGCCCGAAGGAGG + Intronic
968249929 3:197199877-197199899 ATGAGGGTTAGGGATGAAGGAGG + Intronic
968929548 4:3571447-3571469 GTGGGGGTGAGGGAGGAAGCTGG + Intergenic
969414127 4:7047786-7047808 CTTGGGGTGAGGGAGGAAGCTGG + Intronic
969545560 4:7824748-7824770 CTGAGGGAACGGGAGGAAGGGGG + Intronic
971097449 4:23423846-23423868 CTTTGGGGACTGGAGGAAGGAGG - Intergenic
971451509 4:26805641-26805663 CTGTAGGTAAGGGTGGAGGTGGG - Intergenic
971513177 4:27453313-27453335 TTGTGGGGAAGAGAGGGAGGGGG - Intergenic
971893123 4:32551948-32551970 CAGTGGTTAAAGGAGTAAGGGGG - Intergenic
972169110 4:36323267-36323289 CTGTGTCAAAGGGAGGAAGCAGG + Intronic
973146839 4:46837505-46837527 CTGTTGGGAAGGTAGGAATGGGG + Intronic
973532436 4:51846146-51846168 CTTTGGGGAATGGAGGGAGGTGG - Intronic
973639773 4:52891352-52891374 CAGTGGGTAAGTAAGGAAGGTGG + Intronic
974272161 4:59664501-59664523 GTGTGGGTAACGGGGAAAGGAGG - Intergenic
974533829 4:63148771-63148793 CTTGGGGGAAGGGTGGAAGGTGG - Intergenic
974630405 4:64480598-64480620 CTGGGGTTAAGGGAGGGATGAGG + Intergenic
975369439 4:73567977-73567999 CTGTGGAAAGGGGAGGGAGGAGG - Intergenic
976281889 4:83334381-83334403 CTGAGAGTAAGGGAGGGAGAGGG + Intronic
976663647 4:87566479-87566501 ATGTGGGGCAGGGAGGAAGCAGG - Intergenic
977605165 4:98977155-98977177 CTTTGGGAAGTGGAGGAAGGAGG + Intergenic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
978490172 4:109303272-109303294 ATGTGGGAAAGTGAGGGAGGAGG - Intergenic
979435272 4:120680794-120680816 CAGTGGGGAAGGCTGGAAGGAGG + Intergenic
980120287 4:128720924-128720946 CGGTGGGGCAGGGAGGGAGGTGG - Intergenic
981643795 4:146974975-146974997 TGGTGGGGAAGGGAGGAGGGTGG - Intergenic
982106948 4:152019619-152019641 CTGTGGGCAAAGGAAGTAGGTGG + Intergenic
982455181 4:155601391-155601413 CTGTGGGAAAGGGTGGGAGGAGG - Intergenic
982678315 4:158400773-158400795 AAGTGGGTGAGGGAGGGAGGAGG + Intronic
983188837 4:164732819-164732841 CTGCGGGTAAAGTAGGAAGAAGG + Intergenic
983970465 4:173865041-173865063 GTGTGCCTAAGGGAGGAAGTTGG + Intergenic
984228574 4:177065779-177065801 CTGCACGTAAGGGCGGAAGGAGG - Intergenic
984381954 4:179005691-179005713 CTGAGAGTGAGGGAGAAAGGTGG + Intergenic
984921110 4:184765249-184765271 CTGTAGTAAAGGGAGAAAGGAGG - Intronic
985017569 4:185652394-185652416 CTGTGGACAGGGGAGGATGGAGG + Intronic
985273548 4:188216612-188216634 AAGGGGGTAAGGAAGGAAGGAGG - Intergenic
985375547 4:189333649-189333671 TAAGGGGTAAGGGAGGAAGGGGG + Intergenic
986233230 5:5885670-5885692 ATGAGGGTAAGGGTGGAAGGGGG + Intergenic
987091169 5:14509048-14509070 GGGTGGGTAGGGGAGGCAGGTGG - Exonic
987282589 5:16426116-16426138 GGGTGGGGCAGGGAGGAAGGGGG - Intergenic
987409920 5:17604610-17604632 GTGTGGGAAGGGGAGGCAGGGGG + Intergenic
987410566 5:17610819-17610841 ATGTGGGAAGGGGAGGCAGGGGG + Intergenic
987954884 5:24726404-24726426 CTGAAGGGAAGGGTGGAAGGAGG + Intergenic
989563498 5:42877348-42877370 GTGTAGGTTGGGGAGGAAGGAGG - Intronic
991085725 5:62646913-62646935 GTGTGGCAGAGGGAGGAAGGAGG - Intergenic
992545973 5:77814127-77814149 CAGTGGGTTAAGGAGTAAGGGGG - Intronic
993400025 5:87438137-87438159 CTGAGGGTGAGGGAGAAGGGTGG - Intergenic
994013878 5:94942189-94942211 CACTGGGTAAGTGAGGAAGATGG + Intronic
994513693 5:100742255-100742277 CTGGGGGAAAAGGAGGGAGGGGG + Intergenic
994875908 5:105420374-105420396 TTGGGGGGAAGGGTGGAAGGAGG + Intergenic
995044290 5:107626905-107626927 CTTTGGTTTGGGGAGGAAGGAGG - Intronic
995834007 5:116382568-116382590 CTGTGTGTAAGAGAGAAGGGAGG - Intronic
995907197 5:117139646-117139668 CTGTGGATATGGGAGGAGAGAGG + Intergenic
996658511 5:125970613-125970635 ATGTGTGTAAGGGCAGAAGGTGG - Intergenic
996684953 5:126269777-126269799 CTGTGGGAGAGGAATGAAGGTGG + Intergenic
996815114 5:127565869-127565891 CTGAGGGGAGGGGAGGATGGTGG - Intergenic
996853369 5:127977680-127977702 GAGGGGGTGAGGGAGGAAGGAGG - Intergenic
997196128 5:131981121-131981143 GTGTGGGTGGGGGAGAAAGGAGG - Intronic
997264254 5:132485951-132485973 CTGAGGGTGAGGAAGGAAGTAGG - Intronic
997266130 5:132496380-132496402 CTGGGGGTAGGGGTGGAAGTGGG - Intergenic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998133629 5:139663423-139663445 CTGAGGGCGAGGGAGGTAGGAGG + Intronic
998166976 5:139849716-139849738 CGGTGGGAAAGGGAAGAGGGAGG - Intronic
998776790 5:145612607-145612629 TTGGGGGGAAGGGTGGAAGGAGG - Intronic
999208889 5:149870579-149870601 CTGTGTGCATGGGATGAAGGAGG + Intronic
999676281 5:154006352-154006374 CGGTGGGTATGGGTAGAAGGTGG + Intronic
999949528 5:156634105-156634127 CTGTGGGGAAGAGAGGAGAGAGG - Intronic
1000215303 5:159149653-159149675 TTGGGGGAAAGGGTGGAAGGGGG - Intergenic
1001240086 5:170062221-170062243 CTCAGGGTAAGGGAGTAAGGAGG + Intronic
1001412917 5:171523587-171523609 CTGTGGGGAGTGGAAGAAGGAGG + Intergenic
1002923085 6:1587048-1587070 CTGTGGGAAAGGGAGGCTGGAGG - Intergenic
1003130664 6:3392756-3392778 CTGAGGATGTGGGAGGAAGGAGG + Intronic
1003133444 6:3415180-3415202 CTGTGGGCAGGGGAGGGTGGTGG - Intronic
1003261142 6:4517256-4517278 CTGGGGGTGAGGGTGGGAGGAGG - Intergenic
1003582513 6:7353936-7353958 TTGTGGGGAAGTGTGGAAGGGGG + Intronic
1004140256 6:13011684-13011706 CTGTGGGGCAGAGAGTAAGGCGG + Intronic
1004303434 6:14478641-14478663 GTGTGGGTAGGGGAGGAGAGGGG + Intergenic
1004510269 6:16278974-16278996 CTGTGGGCATGGGAGGGAGCTGG + Intronic
1005296347 6:24431239-24431261 CTGTGGACCAGGGTGGAAGGTGG - Intronic
1005913460 6:30330758-30330780 CTGAGGGGTAGGGAGGAAGTGGG - Intronic
1005957798 6:30676784-30676806 CTGTGGTCAAGGGAGGAGGCAGG + Exonic
1006463425 6:34177205-34177227 CCGTGGGCCAGGGAGGGAGGAGG - Intergenic
1006881451 6:37343574-37343596 CTGTGGGTCAGGGATTCAGGTGG + Intergenic
1006929510 6:37679334-37679356 CTGTGGATGCGGGAGGAGGGAGG + Intronic
1007342761 6:41201996-41202018 CTGGAGGCAGGGGAGGAAGGGGG - Intergenic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007375129 6:41451334-41451356 CTGTGGAAAAGGCAGGAGGGAGG - Intergenic
1007424469 6:41737731-41737753 CTGAGGATATAGGAGGAAGGTGG + Exonic
1007476783 6:42124507-42124529 CAGTGGGTAGGGGAGGTACGAGG - Intronic
1007600353 6:43077125-43077147 CTGCGGGTGAGGGCGGAAGAAGG + Intronic
1007697692 6:43744207-43744229 CTATGGCCAAGGGAGGAAGGAGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008198511 6:48556306-48556328 GTATGTGTCAGGGAGGAAGGGGG - Intergenic
1008856476 6:56094325-56094347 CTGTTGATAAAGGAGGAAAGAGG - Intronic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1010168198 6:72941627-72941649 GGGTGGGGAAGGGAGGAGGGAGG - Intronic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1010729379 6:79372993-79373015 CTATGGGGAAGGGATGATGGTGG + Intergenic
1010903256 6:81453898-81453920 CTGAGGATATGTGAGGAAGGAGG - Intergenic
1011389745 6:86838650-86838672 CTGGGGGGAAAGGAGGAAAGGGG + Intergenic
1012491277 6:99785018-99785040 CTGTGGGCAAGAGAGGGAAGAGG + Intergenic
1015012115 6:128362230-128362252 GTGGGAGCAAGGGAGGAAGGAGG + Intronic
1015089003 6:129331384-129331406 CTGAGGGTAAGGATGGGAGGGGG - Intronic
1015454859 6:133415140-133415162 GTGTGGGTAAGTGAGAAAGGAGG - Intronic
1015886782 6:137926032-137926054 CTGGGGGTTAGGGAGGAAGTGGG - Intergenic
1016915665 6:149242109-149242131 ATGTGGGATAGGCAGGAAGGAGG - Intronic
1016944457 6:149515705-149515727 TAGTGGGTAAGTGAGGAAGCAGG - Intronic
1017678355 6:156838561-156838583 CGGTGGGAATGGGAGGATGGGGG + Intronic
1018421209 6:163642368-163642390 CTGGGGGTTAGGGAGGGAGCGGG + Intergenic
1018441096 6:163814100-163814122 TGGTGGGGAAGGGAGGAAAGTGG - Intergenic
1018946146 6:168347923-168347945 CCGCAGGTGAGGGAGGAAGGAGG - Intergenic
1019789292 7:3000361-3000383 CTGTGGGTAAGGGTGGTTGCTGG - Intronic
1020122427 7:5512679-5512701 CTTGGGGTCAGGGAAGAAGGGGG - Intronic
1020738722 7:11986233-11986255 CTGTTTGCAAGTGAGGAAGGAGG - Intergenic
1020816931 7:12917204-12917226 CAATGGGTGAGGGAGGGAGGTGG - Intergenic
1021056458 7:16053316-16053338 GTGTGGGTAGGGGTGGGAGGTGG - Intergenic
1021142726 7:17047676-17047698 TTGTGGGTCAGGGAGGCAGAAGG - Intergenic
1022522842 7:31019144-31019166 GTGTGGGTAGGGCAGGAGGGAGG + Intergenic
1022525811 7:31036476-31036498 CAGTGGGAAAGGGAGGATGCAGG - Intergenic
1022585366 7:31603720-31603742 CTGTGGGAGAGGAAGTAAGGTGG - Intronic
1023743718 7:43303073-43303095 GTGTGGGAGAGGGAGGAAGGTGG - Intronic
1023927528 7:44680789-44680811 CTGTTGGTCAGGAAGCAAGGAGG + Intronic
1024356404 7:48417597-48417619 CTGGGGGCAAGGGAGGCAGAGGG - Intronic
1024537933 7:50453663-50453685 CGGTGGGTGCGGGAGGCAGGTGG + Intronic
1025264436 7:57443261-57443283 TTGTGGGGAAGGGAGGGAGCAGG + Intergenic
1025634769 7:63312844-63312866 TTGTGGGGAAGGGAGGGAGCAGG - Intergenic
1025647926 7:63435326-63435348 TTGTGGGGAAGGGAGGGAGCAGG + Intergenic
1026223366 7:68419582-68419604 CTGTTGGCAAGGAAGAAAGGAGG - Intergenic
1026257320 7:68723863-68723885 CCCTGGGGCAGGGAGGAAGGGGG - Intergenic
1026589295 7:71681518-71681540 CTGTGGGTATCCTAGGAAGGTGG - Intronic
1026632959 7:72053785-72053807 CTGGGGGGAAGGGTGGGAGGGGG - Intronic
1026832165 7:73616878-73616900 CTGAGAGTCAGGGAGGAAAGGGG + Intronic
1026852648 7:73734878-73734900 TTGTGGTGAAGGGAGGAAGGGGG + Intergenic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1027486798 7:78771330-78771352 CTCTGGGAAAGGGAGGGGGGCGG + Intronic
1027941403 7:84685600-84685622 CTGTAGGTAAGGGAAGGAGTTGG + Intergenic
1028440647 7:90856267-90856289 CTGTGGGTTATGGAGGAAAGAGG - Intronic
1028557195 7:92136754-92136776 CTCAGGGAAAGGGTGGAAGGGGG + Intronic
1028662618 7:93297760-93297782 GTTTGGGTAGTGGAGGAAGGTGG + Intronic
1028879577 7:95864973-95864995 TTGTGGGGAAAGGGGGAAGGTGG + Intronic
1029379608 7:100204582-100204604 ATGTGGGAAAGGGAGGAACACGG - Intronic
1029643926 7:101839444-101839466 CTGTGGGTGGGGGAGTAAGTGGG - Intronic
1030064433 7:105648600-105648622 CTGTGTGTATGGGAGGTGGGGGG - Intronic
1030097263 7:105911371-105911393 CTGGGGGAAGGGGAGGAATGAGG + Intronic
1030275858 7:107720908-107720930 AAGTGAGTAAGGGAAGAAGGTGG + Intergenic
1030894226 7:115037615-115037637 CAGTGGGGAAAGGAGGAGGGTGG + Intergenic
1032201444 7:129825548-129825570 CTGTCGGGAAAGGAGGAAGAAGG - Intergenic
1032668786 7:134064765-134064787 GGGTGGGATAGGGAGGAAGGTGG + Exonic
1033659100 7:143391536-143391558 CTGTGGGCAAGGAAGGGTGGGGG + Intronic
1034362652 7:150514204-150514226 ATGTGGGGTAGAGAGGAAGGTGG + Intergenic
1034868153 7:154658263-154658285 CTGAGGGCAGGGGAAGAAGGAGG + Intronic
1035027275 7:155834220-155834242 CTGGGGGGATGGGAGGACGGGGG + Intergenic
1035084831 7:156249176-156249198 CCATGAGTAAGGAAGGAAGGAGG + Intergenic
1035413854 7:158667569-158667591 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035413913 7:158667741-158667763 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035413924 7:158667771-158667793 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035413945 7:158667830-158667852 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035414014 7:158668032-158668054 TAGTGGGTAAGGGAGGGCGGAGG - Intronic
1035414114 7:158668321-158668343 TTGTGGGTAAGGGAGGGCGGAGG - Intronic
1035487157 7:159234890-159234912 CTCTTGTTAGGGGAGGAAGGGGG + Intergenic
1035587276 8:785866-785888 CAGCGGGTGAGGGAGGAGGGAGG - Intergenic
1035893563 8:3372455-3372477 CAGTGGTGAAGGGAGGAAGGTGG + Intronic
1037509094 8:19563599-19563621 CTGTGGGAATAGGAGGAAGCAGG - Intronic
1037700692 8:21271645-21271667 CTGTGGGAAAGGGGAGGAGGAGG - Intergenic
1037833305 8:22201566-22201588 CTGTGGGGAGAGGAGGATGGGGG - Intronic
1037916874 8:22778244-22778266 CTTTGGGTCTGGGAGGAAGGAGG - Intronic
1038156306 8:24993961-24993983 CTGAGGGTGAGGGAAGAAGGAGG + Intergenic
1038251038 8:25904432-25904454 TTGGGGGTAAGGGAAGGAGGGGG + Intronic
1038564917 8:28611719-28611741 CTGTGGGCAAGGGAGCAAAGTGG - Intronic
1038753611 8:30319653-30319675 CGAGGGGGAAGGGAGGAAGGAGG + Intergenic
1038997105 8:32935871-32935893 TTGGGGGGAAGGGTGGAAGGGGG + Intergenic
1039042720 8:33423511-33423533 CTTTGGGAGATGGAGGAAGGAGG - Intronic
1040394754 8:46986700-46986722 CTGTGGGAAACTGAGGTAGGTGG - Intergenic
1040529899 8:48258094-48258116 CTGGGGGAAAGTGAGGCAGGTGG + Intergenic
1040839799 8:51772683-51772705 CTGTGTGGAAGGTGGGAAGGAGG + Intronic
1041044254 8:53876996-53877018 CTGGGGCGAAGGGAGAAAGGAGG + Intronic
1041124648 8:54622860-54622882 CTTTGGATAGGGGAGGAAGAGGG + Intronic
1041799976 8:61788090-61788112 CTATGGGTGGGGTAGGAAGGGGG + Intergenic
1042372762 8:68010763-68010785 AGGTGTGTAGGGGAGGAAGGTGG + Intronic
1043069423 8:75620298-75620320 CTGTTCTTAAGAGAGGAAGGTGG + Intergenic
1043484175 8:80682634-80682656 GTGTGGGTCAGGGTGGAGGGTGG + Intronic
1043593182 8:81853395-81853417 AACTGGGGAAGGGAGGAAGGAGG + Intergenic
1045224830 8:100234421-100234443 CTGAGGGTAGGGGTGGAGGGAGG - Intronic
1045519036 8:102887199-102887221 CTCTGTGTTGGGGAGGAAGGGGG - Intronic
1045870524 8:106921981-106922003 CAGTAGGTCAGGGAGGAAGCTGG - Intergenic
1046097856 8:109581357-109581379 CTGTGAGGAAGGTAGGAAAGGGG - Intronic
1046131731 8:109974810-109974832 GGTTGGGGAAGGGAGGAAGGAGG + Exonic
1047188985 8:122661019-122661041 CTGAATGTAGGGGAGGAAGGTGG - Intergenic
1048277830 8:133080588-133080610 CTGTGGGAAAGGGATGAAGATGG - Intronic
1048606964 8:135978996-135979018 CTGTGGGGAAGGGAAGATAGAGG + Intergenic
1048781976 8:138012110-138012132 ATGTGGCTAATGGAGGAGGGTGG - Intergenic
1048799384 8:138182053-138182075 CTGTGAGTGAGGGAACAAGGAGG - Intronic
1049021412 8:139959950-139959972 CTGTGGGCGATGGAGGAAGGAGG + Intronic
1049094305 8:140539455-140539477 CTAGGGGTACGGGAGGGAGGAGG + Intronic
1049267359 8:141675780-141675802 CTATGGCTCAGGGTGGAAGGTGG + Intergenic
1049368847 8:142253866-142253888 CAGTGGGTGAGGGAGGTGGGAGG + Intronic
1049397087 8:142405911-142405933 CTGTTGCTAAGGGACAAAGGAGG - Intergenic
1049439507 8:142602746-142602768 CTGGGGGCAAGGGATGAGGGTGG + Intergenic
1049789694 8:144466936-144466958 CTGCCGGTCAGGGAGGAGGGCGG - Intronic
1050032466 9:1400952-1400974 CCATAGGTCAGGGAGGAAGGAGG - Intergenic
1050344591 9:4673885-4673907 CTGTGGGTGATGGATGAATGGGG + Intergenic
1050490645 9:6184743-6184765 CTGGAGGTAAGAGAGGATGGTGG + Intergenic
1050811864 9:9758635-9758657 GTTGGGGCAAGGGAGGAAGGAGG - Intronic
1051331888 9:16032133-16032155 CTTTCTGTGAGGGAGGAAGGTGG + Intronic
1051558697 9:18414624-18414646 CTGTGGCTCAGGGAGGAAACTGG + Intergenic
1051604590 9:18907370-18907392 CTGTGGGGTTGGGAGGGAGGGGG - Intronic
1051650053 9:19314125-19314147 TTGGGGGAAAGGGTGGAAGGAGG + Intronic
1052926299 9:34019506-34019528 CTGGGGGTAGGGGAAGAATGGGG + Intronic
1053000711 9:34575921-34575943 CTGTGAGGAGGGGAGGAAAGGGG - Intronic
1053221949 9:36319529-36319551 CTGTGTTTAATGGAGGGAGGAGG + Intergenic
1053484757 9:38443294-38443316 CTTTGGGTCAGGGAGGAGCGAGG + Intergenic
1054460730 9:65461019-65461041 GTGGGGGTGAGGGAGGAAGCTGG - Intergenic
1054770442 9:69078435-69078457 CTGAGAGAAAAGGAGGAAGGTGG - Intronic
1054944136 9:70776674-70776696 CTGTGGGAAAGAGAGAAATGTGG + Intronic
1055353230 9:75411228-75411250 CTTTGGGCAAGGGCCGAAGGTGG + Intergenic
1055705784 9:79001314-79001336 CTGTGGGAAAGAGAAGAAAGAGG - Intergenic
1056900673 9:90596687-90596709 CTAAGGGTAAGGGAATAAGGGGG + Intergenic
1057063801 9:92029272-92029294 CTGTGGGAAAGGAAGGAGGCAGG - Intergenic
1057301820 9:93890796-93890818 CTGTGGGTTAGAGATGGAGGAGG + Intergenic
1057312223 9:93949642-93949664 CTGTGGGTCAGTGGGGAAGTTGG - Intergenic
1057483838 9:95466552-95466574 CTGTGTGTGGGTGAGGAAGGGGG + Intronic
1057754569 9:97821730-97821752 CTGAGGCTAAGAGAGGAAAGGGG + Intergenic
1057899893 9:98940461-98940483 CTGTGGGTGTGGGAGGGATGGGG - Intergenic
1058179459 9:101779139-101779161 GTGTGGGTGGGGGAGGAAGCTGG - Intergenic
1058839314 9:108890884-108890906 CTGTGGGGAAGGAAGGAGAGTGG - Intronic
1058925493 9:109659388-109659410 GGGTGGGTAAGGGAGTAGGGGGG - Intronic
1058969986 9:110072325-110072347 CTGTGGCTAAGGGTGGCAAGGGG + Intronic
1059268227 9:113056028-113056050 CAGTGGGTAATGGAGGAATCGGG - Intronic
1059306670 9:113358836-113358858 CTGTGGGTAAGGCATTAAAGTGG + Intronic
1059354273 9:113687211-113687233 GGGTGGGGAAGGGAGGGAGGAGG + Intergenic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1060429889 9:123541862-123541884 CTGCGGTTCAGGGAGGAGGGAGG + Intronic
1060728067 9:126018979-126019001 CTTTGGGAGACGGAGGAAGGCGG + Intergenic
1060829767 9:126706134-126706156 CTGCGGGTGAGGGTGGGAGGTGG - Intergenic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1060990322 9:127845271-127845293 CTGTGGGAAGGTGAGGAAGGAGG - Intronic
1060991753 9:127853589-127853611 CTGGGGATCAGGGAGGTAGGAGG + Intronic
1061138820 9:128752146-128752168 CTGAGGATCAGGAAGGAAGGAGG - Intronic
1061146873 9:128804970-128804992 CTTTGGGAGAGGGAGGTAGGCGG - Intronic
1061213775 9:129208595-129208617 CTGTGGGGAAGACAGGAAGTGGG - Intergenic
1061396680 9:130347379-130347401 CTGGGGGCAAGAGAGGAAAGCGG + Intronic
1061715898 9:132518722-132518744 CTCTGGGGATGGGTGGAAGGTGG - Intronic
1061722066 9:132557972-132557994 CCGTGGGCACGGGAGGGAGGTGG - Intronic
1062068161 9:134540041-134540063 CTGTGGGACAGGGAGGAGGTAGG - Intergenic
1062114642 9:134801849-134801871 CTGGGGGGAAGGGAGGTGGGGGG + Intronic
1062675329 9:137739860-137739882 TTGTCGGGCAGGGAGGAAGGAGG + Intronic
1185475664 X:413906-413928 CCGTGGGTCCTGGAGGAAGGAGG - Intergenic
1185556923 X:1028895-1028917 CTGTGAGGTAGGTAGGAAGGTGG + Intergenic
1185758958 X:2674625-2674647 CTCGGGGTAAGGGTGGAAGGTGG - Intergenic
1186071099 X:5821550-5821572 CTAGGGGTCAGGGAGGGAGGGGG + Intergenic
1186202560 X:7169131-7169153 GTGGGGGTATGGGAGGAATGTGG - Intergenic
1186207219 X:7213456-7213478 CGGTGGGAAAGGCAGGCAGGAGG + Intergenic
1186632636 X:11366588-11366610 ACGTGGGTAAGTGAGGGAGGTGG + Intronic
1186672348 X:11780550-11780572 CAGAGGGGAAGGAAGGAAGGAGG - Intergenic
1186912367 X:14182314-14182336 CTGTGGATAGTGGAGGAGGGAGG - Intergenic
1187197224 X:17099325-17099347 ATGTGGGAGAGGGAGGAATGGGG - Intronic
1187357597 X:18591778-18591800 CTGAGTCTAGGGGAGGAAGGAGG - Intronic
1187693589 X:21896358-21896380 CTGGGGGGAAGGGAGGAGTGGGG - Intergenic
1187765172 X:22633603-22633625 CTCTGGGAAAGAGAAGAAGGGGG + Intergenic
1188112808 X:26212095-26212117 CTGTGGGGAAGGGTGGGGGGTGG + Intergenic
1188535732 X:31194734-31194756 TTGTGGGCAAGGCAGGAGGGTGG + Intronic
1189203078 X:39214625-39214647 CTGTTGGAGAGGGAGGAATGGGG + Intergenic
1189291045 X:39886334-39886356 CTTTGTGGAAGGGAGGAAGGAGG + Intergenic
1189365574 X:40385367-40385389 CAGTGGGTAAGAGAAGAAGCTGG + Intergenic
1189847537 X:45150851-45150873 TTGTGTGTAAGGAAAGAAGGAGG - Exonic
1190401687 X:50042668-50042690 CCAGGGGTTAGGGAGGAAGGAGG - Intronic
1191103447 X:56757890-56757912 GTGTGGGTATTGGAGGAGGGTGG + Intergenic
1191634773 X:63363645-63363667 CTGAGGGACAGGGAGGTAGGTGG + Intergenic
1192130408 X:68544247-68544269 CTGTGGGGGAGGGAGGAAAGGGG + Intergenic
1192405289 X:70879109-70879131 CTGAGGGTGAGGGAGGGAAGAGG + Intronic
1192556358 X:72092671-72092693 CTGTGAGTGAGGGAGGCATGGGG + Intergenic
1193456699 X:81740134-81740156 CTGGGGGAAAGGAAGGAAGGAGG - Intergenic
1193826005 X:86228113-86228135 TTGGGGGTAAGAGTGGAAGGGGG - Intronic
1195206454 X:102604412-102604434 CTCTGGGGAAGGGAGTAAGGAGG + Intergenic
1195917734 X:109952361-109952383 CTTTGGGCAGGAGAGGAAGGAGG - Intergenic
1195967876 X:110445484-110445506 CTGTGGGGGAGGAAGGAAGTGGG + Intronic
1196203986 X:112918337-112918359 CTGTAGGAAAGAGAGGGAGGGGG - Intergenic
1196893532 X:120311574-120311596 CTGAGGGGGAGGGAGGAGGGGGG - Intergenic
1197013592 X:121596928-121596950 CTGTGGGTAGAAGAGGAAAGAGG + Intergenic
1197170344 X:123426924-123426946 CTGTGTGTGGGGGTGGAAGGGGG + Intronic
1197180934 X:123535837-123535859 TTGTGGGTGGGGGAGGGAGGAGG + Intergenic
1197262347 X:124332741-124332763 CAGGGAGTGAGGGAGGAAGGAGG + Intronic
1197595499 X:128459239-128459261 CAGTGGGGAAGGGAGAAAGTTGG - Intergenic
1197776459 X:130121546-130121568 CTGTCGGGACGGGAGGAAGAGGG - Intergenic
1197899011 X:131348428-131348450 TTGTGGGGAAGGGATGAAGATGG - Intronic
1198295520 X:135283060-135283082 CTGGGAGTTAGGGAGGAAGTAGG - Intronic
1198451191 X:136768047-136768069 CTGGGGGTGAGGGAGGAAGCAGG - Intronic
1199535267 X:148895591-148895613 GTGTGTGTAAGAGAGGGAGGGGG + Intronic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1199954769 X:152734351-152734373 CTGTGGCTCAGGGAGGGAAGGGG + Intronic
1200103672 X:153700911-153700933 CTGCAGGCAGGGGAGGAAGGAGG + Exonic
1200749120 Y:6928882-6928904 CAGTTGGTAGGGGAGCAAGGTGG + Intronic
1201239782 Y:11947561-11947583 GTCTGGGTCAGGGAGGAAGCGGG + Intergenic