ID: 921711170

View in Genome Browser
Species Human (GRCh38)
Location 1:218374798-218374820
Sequence TTGAACTCACAGAGGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 473}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921711170_921711175 2 Left 921711170 1:218374798-218374820 CCCTGCTCCCTCTGTGAGTTCAA 0: 1
1: 0
2: 2
3: 35
4: 473
Right 921711175 1:218374823-218374845 TGCTGTCACTGGAGTTATAAAGG 0: 1
1: 0
2: 1
3: 9
4: 165
921711170_921711179 26 Left 921711170 1:218374798-218374820 CCCTGCTCCCTCTGTGAGTTCAA 0: 1
1: 0
2: 2
3: 35
4: 473
Right 921711179 1:218374847-218374869 ACATTTAGGCTTGTGTTCTTGGG 0: 1
1: 0
2: 0
3: 14
4: 221
921711170_921711174 -9 Left 921711170 1:218374798-218374820 CCCTGCTCCCTCTGTGAGTTCAA 0: 1
1: 0
2: 2
3: 35
4: 473
Right 921711174 1:218374812-218374834 TGAGTTCAAACTGCTGTCACTGG 0: 1
1: 0
2: 0
3: 17
4: 110
921711170_921711176 3 Left 921711170 1:218374798-218374820 CCCTGCTCCCTCTGTGAGTTCAA 0: 1
1: 0
2: 2
3: 35
4: 473
Right 921711176 1:218374824-218374846 GCTGTCACTGGAGTTATAAAGGG 0: 1
1: 0
2: 1
3: 14
4: 183
921711170_921711177 12 Left 921711170 1:218374798-218374820 CCCTGCTCCCTCTGTGAGTTCAA 0: 1
1: 0
2: 2
3: 35
4: 473
Right 921711177 1:218374833-218374855 GGAGTTATAAAGGGACATTTAGG 0: 1
1: 0
2: 1
3: 25
4: 379
921711170_921711178 25 Left 921711170 1:218374798-218374820 CCCTGCTCCCTCTGTGAGTTCAA 0: 1
1: 0
2: 2
3: 35
4: 473
Right 921711178 1:218374846-218374868 GACATTTAGGCTTGTGTTCTTGG 0: 1
1: 0
2: 0
3: 19
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921711170 Original CRISPR TTGAACTCACAGAGGGAGCA GGG (reversed) Intronic
900917277 1:5647559-5647581 TGCAGCTCACACAGGGAGCATGG + Intergenic
901787530 1:11634556-11634578 CTGCCCTCACAGAGGGAGTATGG - Intergenic
902048761 1:13545265-13545287 ATGAACTCACAGAAGGTGCTGGG - Intergenic
903706490 1:25289604-25289626 ATTAACTCCCAGAGGGAGGAGGG + Intronic
903720749 1:25403754-25403776 ATTAACTCCCAGAGGGAGGAGGG - Intronic
904172766 1:28603061-28603083 TTGAAATCCCAGAGGGAGTCAGG - Intronic
904879203 1:33682074-33682096 TGGAGCTTCCAGAGGGAGCATGG - Intronic
904903772 1:33878546-33878568 TTGATCTGACAGTGGCAGCAAGG + Intronic
905908906 1:41640411-41640433 TTGCACCCAGAGAGGGAACACGG - Intronic
907410001 1:54277107-54277129 ATGAAGTCACAGAAGGAGAAAGG - Intronic
907842316 1:58169885-58169907 TTCAAATCAGAGAGGGAGAAGGG - Intronic
908071384 1:60464172-60464194 ATGAACTCACAGAGGATCCAAGG - Intergenic
908300388 1:62756509-62756531 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
909069485 1:70977341-70977363 TTCAGCCCACAGAGGCAGCATGG - Intronic
909914057 1:81295640-81295662 TGGAACTTAGAGAGGGAGGAAGG - Intergenic
910397471 1:86806912-86806934 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
910746532 1:90580792-90580814 GTGAAAGCAAAGAGGGAGCAAGG - Intergenic
910846598 1:91610359-91610381 GTTATCTCACAGAGGAAGCAGGG - Intergenic
911129800 1:94376571-94376593 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
911529813 1:99031216-99031238 TAGAACTGTCAGAGAGAGCATGG + Intergenic
911751386 1:101501120-101501142 TTTAAATCAGAGAGGGAGGAGGG - Intergenic
911809659 1:102259713-102259735 TGAAACTCACAGAAGTAGCATGG - Intergenic
911845648 1:102747854-102747876 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
912021271 1:105111269-105111291 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
913469488 1:119174544-119174566 TTTAAATCACAGAGGGAGAAGGG - Intergenic
915260536 1:154673736-154673758 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
915277917 1:154802392-154802414 TTGAAAAAACACAGGGAGCAGGG + Intronic
916083601 1:161252376-161252398 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
916114410 1:161474813-161474835 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
916488596 1:165281070-165281092 TTGAGGTCACAGAGTTAGCAAGG - Intronic
916939500 1:169664257-169664279 TTTAAATCAGAGAGGGAGAAGGG - Intronic
916979733 1:170120919-170120941 TTGAACTCACAGAGATAGAGAGG - Intergenic
917086100 1:171307099-171307121 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
917227548 1:172800643-172800665 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
917279855 1:173370097-173370119 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
917281132 1:173378958-173378980 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
917281183 1:173379356-173379378 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
917445826 1:175105269-175105291 TTTAAATCAGAGAGGGAGAAGGG + Intronic
917676251 1:177321862-177321884 TTTAAATCAGAGAGGGAGCAGGG - Intergenic
918099032 1:181357549-181357571 CTGAACTCACAGAGGCTGCCTGG - Intergenic
918191266 1:182176740-182176762 TTGAACTCACAGGCGGGACATGG - Intergenic
918750204 1:188261481-188261503 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
919116826 1:193290451-193290473 ATGAAATCAGAGAGGGAGTAGGG + Intergenic
921019673 1:211224434-211224456 TTTAAATCACAGAGGGAGAAGGG - Intergenic
921079314 1:211725942-211725964 TTTAAATCACAGAGGGGGCCGGG - Intergenic
921711170 1:218374798-218374820 TTGAACTCACAGAGGGAGCAGGG - Intronic
923084639 1:230694286-230694308 TTGAACTCACATAGGCAGCATGG + Intergenic
1063321726 10:5057989-5058011 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1063859110 10:10289472-10289494 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
1064603591 10:17016598-17016620 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1065082387 10:22141043-22141065 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1066298240 10:34074907-34074929 TTGCAGTCACGGAGGAAGCAGGG - Intergenic
1066614597 10:37282384-37282406 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1067161678 10:43830773-43830795 TTGAACTCACAGAAGCAGAGAGG + Intergenic
1067847681 10:49736661-49736683 TTGAACTAAAAGATGGAGCAGGG + Intronic
1068404975 10:56575976-56575998 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1068407004 10:56603180-56603202 GTGAACTTACAGAGTAAGCAAGG + Intergenic
1069053162 10:63815694-63815716 TGGAACTCCCAGAGGGAGTGTGG - Intergenic
1069365110 10:67688188-67688210 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1071834835 10:89408611-89408633 TTTAAATCAGAGAGGGAGCAGGG - Intronic
1073739830 10:106393849-106393871 TTGTACTTTCAGAGGGAGCATGG - Intergenic
1073970730 10:109043516-109043538 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1074613018 10:115039293-115039315 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1074965571 10:118487962-118487984 TTGAGCTCACAAAGTGAGGAAGG - Intergenic
1075679643 10:124323075-124323097 GTGAACTCCCAGAGGGAGAGGGG + Intergenic
1076514283 10:131034431-131034453 GGGGACTCACAGAGGGGGCACGG - Intergenic
1077135550 11:996401-996423 AGGAACTCGCTGAGGGAGCATGG + Intronic
1077311848 11:1892277-1892299 TTGTACTCACTAAGGGGGCAGGG + Intergenic
1077501872 11:2912975-2912997 TGGAGCTCAGAGAGGGAGGAGGG + Intronic
1077933373 11:6756825-6756847 TGGCCCTCACACAGGGAGCAGGG - Intergenic
1078637931 11:13069245-13069267 TTGGGCTCACAGAGGCACCAGGG - Intergenic
1079731239 11:23939342-23939364 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1079811677 11:25005068-25005090 TTTAAGTCAGAGAGGGAGAAGGG + Intronic
1080881829 11:36328494-36328516 TGGAAAACAAAGAGGGAGCAAGG - Intronic
1081145977 11:39562915-39562937 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1081930658 11:46868590-46868612 TCCAACTCACCAAGGGAGCAGGG + Exonic
1082906151 11:58310447-58310469 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1083105649 11:60356191-60356213 TAGAACTTAGTGAGGGAGCAGGG + Intronic
1084038448 11:66527781-66527803 TGGAGCACACAGAGGGAGTAAGG + Intronic
1084210989 11:67622268-67622290 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1086317374 11:85608731-85608753 TTTAAATCAGAGAGGGAGAAAGG - Intronic
1086412803 11:86559151-86559173 GAGAACTCACAGAGGAGGCAGGG + Intronic
1087074985 11:94120418-94120440 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1087289653 11:96306430-96306452 TTCAAGTCACAAAGGGAGCTAGG - Intronic
1087335817 11:96843004-96843026 CTGAAGTCAATGAGGGAGCATGG - Intergenic
1087459012 11:98422759-98422781 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1087683346 11:101238426-101238448 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1087994694 11:104789646-104789668 TTGATCTCATAGAGGGAGAGAGG + Intergenic
1088492527 11:110401620-110401642 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1089580127 11:119476467-119476489 TGGAAGTCACAGGGGGACCAAGG + Intergenic
1091664794 12:2411463-2411485 TTTAGCCCACAGAAGGAGCAGGG - Intronic
1092472285 12:8790506-8790528 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1093345231 12:18033519-18033541 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1093580588 12:20781053-20781075 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1094050350 12:26213633-26213655 TTGAAATAACAGAGCCAGCAAGG + Intronic
1094090680 12:26645592-26645614 TTGAATGCCCAGAGGCAGCATGG + Intronic
1094338119 12:29383520-29383542 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1094399292 12:30044389-30044411 TGGAAACCACAGAAGGAGCACGG + Intergenic
1094642761 12:32292152-32292174 TAGAGCTGCCAGAGGGAGCATGG - Intronic
1095088479 12:38083623-38083645 TGGAACTCCCAAAGAGAGCAAGG + Intergenic
1096258027 12:50074576-50074598 TTGACCTCACAGATGGAGCAAGG - Intronic
1096783092 12:54001915-54001937 TTGAACTCCAAGCGGGAGGATGG + Intronic
1097428290 12:59473102-59473124 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1098624114 12:72641006-72641028 TTGTACTCACAGAGCAAGAAGGG + Intronic
1099376237 12:81898669-81898691 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1099414753 12:82372223-82372245 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1099470873 12:83046424-83046446 TTGAACTAAAATAGAGAGCAAGG - Intronic
1100209784 12:92388836-92388858 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1101081463 12:101189675-101189697 ATGAACGCACAGAGGTAGGAAGG - Intronic
1101520740 12:105479762-105479784 TTGTTGTAACAGAGGGAGCAGGG + Intergenic
1101570406 12:105948356-105948378 CTGAACCCACAGAGTGGGCAAGG - Intergenic
1101704865 12:107212085-107212107 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1101779650 12:107823954-107823976 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1102011068 12:109618618-109618640 TGGAAAGCAGAGAGGGAGCAGGG + Intergenic
1103845914 12:123902023-123902045 TAGAGCTTTCAGAGGGAGCATGG - Intronic
1104024418 12:125015430-125015452 TTGAACTTTCAGAGGGAGTGTGG + Intronic
1104045987 12:125163344-125163366 TTGAAATCACGGAGGAATCAGGG - Intergenic
1104306174 12:127612500-127612522 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1104526568 12:129529447-129529469 TTGGACACAGAGAGAGAGCATGG - Intronic
1105717833 13:23084878-23084900 TGGAACACACAGAGGAGGCATGG + Intergenic
1105762474 13:23527070-23527092 TTTAAGTCAGAGAGGGAGAAGGG - Intergenic
1106115671 13:26815616-26815638 TTGCACTCCCACTGGGAGCAAGG + Intergenic
1106162680 13:27214952-27214974 TTTAAATCATAGAGGGAGAAGGG - Intergenic
1106470536 13:30050313-30050335 TGGAGCCTACAGAGGGAGCATGG - Intergenic
1106776191 13:33012284-33012306 TTGAACTCACAGAAGCAGAGAGG + Intergenic
1107340167 13:39396946-39396968 TAGAACCTTCAGAGGGAGCATGG + Intronic
1108107279 13:47024791-47024813 TGGGACACAGAGAGGGAGCAGGG - Intergenic
1108332699 13:49405966-49405988 TTGAACTCACAGAGATAGAGAGG + Intronic
1108848590 13:54702476-54702498 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1109280350 13:60348775-60348797 TTGAGCTCCCACAGGGAGCCGGG + Intergenic
1109360531 13:61289561-61289583 TTGAATTCACAGAGGGAGTTTGG + Intergenic
1109501018 13:63236114-63236136 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
1110738410 13:78965584-78965606 TACAACTCACAGAGTGAGGATGG - Intergenic
1111280657 13:86018943-86018965 ATGAAATGACAGAGGGAGAAAGG + Intergenic
1111372520 13:87335751-87335773 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1112519108 13:100080511-100080533 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1112538359 13:100283028-100283050 TTTAAATCAGAGAGGGAGAAGGG - Intronic
1113551516 13:111196536-111196558 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1113758496 13:112831268-112831290 TTCAAGTCACAGTGGGAGCTGGG + Intronic
1115285470 14:31709703-31709725 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1117161683 14:52995847-52995869 TTGAGGTCAGAGAGGTAGCAGGG + Intergenic
1118480582 14:66161105-66161127 CTGAGCTCACCTAGGGAGCAGGG + Intergenic
1118507040 14:66424882-66424904 TAGAACTTTCAGAGGGAGCATGG - Intergenic
1118720321 14:68589408-68589430 TTTAACTCACTGAGGTAGCCTGG - Intronic
1119412807 14:74445097-74445119 GTGAACTCATAGAGTGAGAACGG - Intergenic
1120040174 14:79743793-79743815 TTGCACTGACTGAGGAAGCAAGG + Intronic
1120198779 14:81515229-81515251 TTTAAATCAGAGAGGGAGGAGGG - Intronic
1121998709 14:98628032-98628054 CTAAAGTCTCAGAGGGAGCATGG + Intergenic
1122640939 14:103158896-103158918 CAGAACTCACAAAGGGAGGAGGG - Intergenic
1122683895 14:103489118-103489140 TTTAACTCTCAGAGGGAAAATGG + Intronic
1125756553 15:42069269-42069291 TAGAACTCACGGTGGAAGCAAGG + Intronic
1126072085 15:44874182-44874204 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1126086105 15:45012484-45012506 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1128355730 15:66925173-66925195 ATGAATTCACAGATGGAGCCTGG + Intergenic
1129412731 15:75358926-75358948 TGGAACCCACACATGGAGCAGGG - Intronic
1129997461 15:80018904-80018926 TTGACCTCACAGAATGAGCTAGG + Intergenic
1130107643 15:80941034-80941056 TTGGACTCACAGAGGGGCCATGG - Intronic
1130882818 15:88069808-88069830 CTGAACTCACAGAGGGAAGCTGG + Intronic
1131352420 15:91713326-91713348 TAGACCTATCAGAGGGAGCATGG - Intergenic
1131411190 15:92209532-92209554 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1131761595 15:95628736-95628758 TTGAAGTCCCAGAGAGAGCAAGG + Intergenic
1132801641 16:1757630-1757652 CTGAAGTCACAATGGGAGCAAGG - Intronic
1133334446 16:4997739-4997761 TAGAACTTTCAGAGGGAGCACGG - Intronic
1134855864 16:17518520-17518542 TTGAACCCAAACAGGGAGGAGGG + Intergenic
1135339690 16:21635218-21635240 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1138003120 16:53303008-53303030 GTGAACTCACAGGGGCAACAAGG - Intronic
1138552729 16:57756317-57756339 ATGAAGTCACAGATGGACCAAGG - Intronic
1140418597 16:74797020-74797042 TTGAATTCCCAGAGGGAGGGAGG + Intergenic
1141086626 16:81100311-81100333 TAGAGCCCTCAGAGGGAGCATGG + Intergenic
1141437637 16:84009456-84009478 TAGAGCCCACAGAGGGAGCATGG + Intergenic
1141518159 16:84560034-84560056 TAGAGCTTCCAGAGGGAGCATGG - Intergenic
1143999790 17:11042214-11042236 TCAAACAGACAGAGGGAGCAAGG - Intergenic
1144203512 17:12962698-12962720 TGGAAATCAAGGAGGGAGCAAGG - Intronic
1145046038 17:19617068-19617090 TTCATCTCACAGAGATAGCAGGG - Intergenic
1146310492 17:31764706-31764728 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1147230840 17:39016642-39016664 TTGAACCCAAAGAGGGGTCATGG + Intergenic
1149209646 17:54288460-54288482 TTGAAATCAGAGAGGGTGAAGGG - Intergenic
1149459325 17:56814328-56814350 ATCTACTCACAGAGGGAGCCTGG + Intronic
1150438355 17:65171484-65171506 TTGAGCTGAGAGAGGGACCACGG - Intronic
1150800044 17:68274096-68274118 TTTAACTCACAGAGGCTTCAGGG + Intronic
1151259060 17:72902434-72902456 TTGAGCCTTCAGAGGGAGCATGG + Intronic
1151567996 17:74910581-74910603 TTTAAGTCAGAGAGGGAGAAAGG - Intergenic
1152273749 17:79341715-79341737 CAGAACTCAGAAAGGGAGCAAGG - Intronic
1152610682 17:81313808-81313830 TTCATCTCACAGAGGCAGCTGGG + Exonic
1153438034 18:5087681-5087703 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
1155356945 18:24962094-24962116 TAGAACCCACATAGTGAGCATGG - Intergenic
1155398874 18:25416572-25416594 TTGAACTCAGAGAGCCAGCAGGG - Intergenic
1157722616 18:49937043-49937065 AGGAACTAACAGAGGGAGGAGGG - Intronic
1157857915 18:51118265-51118287 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1159262588 18:66034576-66034598 GGGAACTCAGAGAGAGAGCATGG - Intergenic
1159438204 18:68445337-68445359 TAGAGCTTCCAGAGGGAGCACGG - Intergenic
1160127301 18:76187952-76187974 TTGAACTCACAGAAGCAGAGTGG - Intergenic
1160586404 18:79915743-79915765 TGGCACTCACCCAGGGAGCAGGG + Intronic
1160623095 18:80184494-80184516 TGAAACCCGCAGAGGGAGCAAGG + Intronic
1160623106 18:80184546-80184568 TGAAACCCTCAGAGGGAGCAAGG + Intronic
1161322306 19:3646932-3646954 AGGCACTCACAGAGGGAGGAGGG + Intronic
1161322398 19:3647240-3647262 AGGCACTCACAGAGGGAGGAGGG + Intronic
1162237492 19:9320747-9320769 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1162641616 19:12014639-12014661 GAGAAGTCACAGAGGGAGAATGG - Intergenic
1163852718 19:19674668-19674690 TTGACCTCATAGAGGGAGTTTGG + Intronic
1164516837 19:28943862-28943884 TACAATGCACAGAGGGAGCAGGG - Intergenic
1164992968 19:32697865-32697887 TTAAAATCAGAGAGGGAGAAGGG + Intronic
1165813749 19:38628369-38628391 GGAAACTCACAGAGGGAGGAGGG - Intronic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1167608003 19:50492127-50492149 TGGAACTCACTGAAGGTGCAGGG + Intergenic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
925204113 2:1992013-1992035 TTGATGTGACAGAGGCAGCAAGG - Intronic
925616826 2:5751650-5751672 TGGAAGTCACAGAGCCAGCAGGG - Intergenic
925628369 2:5864570-5864592 TAGAGCTGACAGAGAGAGCATGG + Intergenic
925949922 2:8900479-8900501 TTTAAATCAGAGAGGGAGAAGGG + Intronic
926689900 2:15725928-15725950 TGGAACTTTCAGAGGGAGCCTGG - Intronic
927522459 2:23707653-23707675 TTGACCTCATGGAGGGAGCTGGG - Exonic
930038500 2:47102805-47102827 TTTAAATCAGAGAGGGAGAAGGG - Intronic
931540464 2:63324469-63324491 TTTAAATCAGAGAGGGAGAAGGG - Intronic
931638005 2:64357935-64357957 ATGAACACAGAGAGGGATCATGG - Intergenic
932872184 2:75412994-75413016 GGGAACTCACAGAGGGAGTTGGG + Intergenic
933342128 2:81037482-81037504 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
934155104 2:89191619-89191641 TTGAACTCACATCAGCAGCATGG + Intergenic
934212209 2:89991105-89991127 TTGAACTCACATCAGCAGCACGG - Intergenic
934867097 2:97823324-97823346 TTTAAATCAGAGAGGGAGAAGGG - Intronic
936602364 2:113910453-113910475 TTGAACTCAAGGAGGGAGTATGG + Intronic
937342191 2:121098428-121098450 TTGAAGTCACACAGGGAGAAGGG - Intergenic
938226596 2:129621960-129621982 TTGAACTCACAGAAGCAGAGTGG + Intergenic
938806217 2:134809179-134809201 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
938926941 2:136052101-136052123 TGGAATACACAGAGGGAGCTGGG + Intergenic
938954635 2:136286486-136286508 TTCAAGTTTCAGAGGGAGCATGG - Intergenic
939181501 2:138808321-138808343 TTGAACTCACAGAAGCAGAAAGG - Intergenic
939851828 2:147313609-147313631 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
941243387 2:163068982-163069004 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942248214 2:174026234-174026256 CTGAACTCTCGGAGGGAGCACGG + Intergenic
943133723 2:183887664-183887686 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
943535715 2:189147482-189147504 TACAACTCACAGAGGAATCATGG + Intronic
944728972 2:202499139-202499161 TTTAAATCAGAGAGGGAGAAGGG - Intronic
945681955 2:212924966-212924988 TAGAGTTCCCAGAGGGAGCATGG - Intergenic
945712781 2:213320605-213320627 TTGATCTCATGGAGGTAGCAGGG - Intronic
946207386 2:218119710-218119732 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
947964397 2:234267339-234267361 TTGGACTCAAGGAGGGAGTAGGG + Intergenic
948080551 2:235202213-235202235 TGGAACCCCCAGAGGGAGCGTGG - Intergenic
948876952 2:240834569-240834591 TTGCACCCACAGAGGGCGCAAGG + Intergenic
1170649186 20:18224452-18224474 TAGCACCCTCAGAGGGAGCACGG - Intergenic
1171047464 20:21824136-21824158 TTGAAGTCAAAGTGGGAACAGGG + Intergenic
1171261480 20:23738152-23738174 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
1172340623 20:34154656-34154678 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1172388189 20:34548398-34548420 TTGAGGTCACGGAGGGAGAAGGG + Intronic
1173252247 20:41370177-41370199 TTGCAGTGAAAGAGGGAGCATGG - Intergenic
1173753195 20:45492775-45492797 TTGAAGTCAGAGAGGTAGCATGG + Intergenic
1174384378 20:50178418-50178440 GTGAACACACAGAGGGAAGAAGG + Intergenic
1174855116 20:54037226-54037248 TGGAAGTCAAAGGGGGAGCAAGG + Intronic
1175133677 20:56807666-56807688 CTCCACTCACAGAGGAAGCATGG - Intergenic
1175461776 20:59157225-59157247 TTGAACTCACAGAGATAAGAGGG - Intergenic
1175726856 20:61324412-61324434 TAGAACTACCGGAGGGAGCATGG - Intronic
1177135037 21:17299014-17299036 TTTAAATCAGAGAGGGAGGAGGG - Intergenic
1179310507 21:40191722-40191744 TAGAGCTCTTAGAGGGAGCATGG - Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1182174957 22:28275700-28275722 TTAAACTCACAGTGGGAGGGAGG + Intronic
1183192915 22:36333094-36333116 TGGGACACACACAGGGAGCATGG + Intronic
1183788699 22:40047215-40047237 TTGAATTATCAGAGGGAGAAAGG + Intronic
1184186985 22:42871546-42871568 TTGAGCCCACAGAGGGTGGAGGG + Intronic
1184403902 22:44289270-44289292 TTGAAGTCAGAGAGGGACCTGGG - Intronic
1184591136 22:45484181-45484203 TGCAACACACAGAGGGATCAGGG - Intergenic
949102510 3:163076-163098 TTGAAGGCAGAGAGGAAGCAGGG - Intergenic
950576376 3:13834507-13834529 ATGAAGTCAAAGAGGCAGCAGGG - Intronic
950955205 3:17045796-17045818 TTGACCTCAGAAAGGGAGAAAGG + Intronic
951020460 3:17776694-17776716 TTTAAATCAGAGAGGGAGAAGGG - Intronic
951145207 3:19218733-19218755 TAGCACCAACAGAGGGAGCAGGG - Intronic
951239446 3:20271908-20271930 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
951564011 3:23994462-23994484 TTGAACTCAGACATGGACCAGGG + Intergenic
952452998 3:33448870-33448892 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
952555078 3:34522078-34522100 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
952657010 3:35799045-35799067 TTGAACACACAGAGATAGGATGG + Intergenic
952940981 3:38444223-38444245 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
954586951 3:51744556-51744578 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
954598898 3:51852392-51852414 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
954712668 3:52512805-52512827 CTGCACGCACACAGGGAGCAGGG - Intronic
954792871 3:53145872-53145894 ATGATCACACAGAGTGAGCAGGG - Intergenic
954990594 3:54837655-54837677 TAGAACCTTCAGAGGGAGCATGG - Intronic
956791064 3:72680479-72680501 ATGTACTCACAGTGGGAGGATGG - Intergenic
956842991 3:73157275-73157297 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
957032676 3:75260413-75260435 TTAAACTCAGAGAGGGTACAAGG - Intergenic
959502170 3:107119059-107119081 TTGACCCAACAGAAGGAGCATGG - Intergenic
959711701 3:109392285-109392307 TTAAACTCACAGAGGAATAAAGG - Intergenic
959717242 3:109446017-109446039 TTGAACTTATAGAGGAAGAAGGG + Intergenic
961619825 3:128215276-128215298 TTGAGCACACAGAGGCAACATGG + Intronic
961760208 3:129161653-129161675 TTGCTCTCACAGAGGAACCAAGG - Intergenic
962000390 3:131289222-131289244 TTGAACTCACAGAGACACCAGGG - Intronic
962493647 3:135918292-135918314 ATGAAATCACGGAGGGAGCTGGG - Intergenic
963080424 3:141387593-141387615 TTGAACTCTCAGAGGAGGAAGGG + Intronic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
963422525 3:145078288-145078310 TAGAACTTTCAGAGGGAGCATGG - Intergenic
963696721 3:148573064-148573086 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
964665760 3:159170182-159170204 TTGACCTCTCAGTGGAAGCATGG - Intronic
964972207 3:162576752-162576774 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
965062719 3:163803815-163803837 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
966269095 3:178083434-178083456 TTGAATTCTCGGAGTGAGCAGGG + Intergenic
966798706 3:183741855-183741877 TTGATCTCACAGATGCAGAATGG - Intronic
966846488 3:184134727-184134749 TTGAACTCTCAGAAGGATGAAGG - Intergenic
967735041 3:192942824-192942846 TAGAACTTTCAGAGAGAGCATGG + Intergenic
968847253 4:3051615-3051637 TTGAACACACAGAGAGAGAGAGG - Intergenic
969366297 4:6696356-6696378 CTGAAGTCACACAGGGAGCCGGG - Intronic
970564252 4:17315969-17315991 TCGAGCTTTCAGAGGGAGCACGG - Intergenic
971281240 4:25244144-25244166 TTTAAATCAGAGAGGGAGAAGGG + Intronic
971379749 4:26085855-26085877 TAGAGCCCGCAGAGGGAGCATGG + Intergenic
971552423 4:27974600-27974622 GTTAAATCACAGAGGGAGGAAGG - Intergenic
971578436 4:28305247-28305269 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
972133342 4:35862962-35862984 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
972878252 4:43392657-43392679 TGGCACTCACAGAGGGACCATGG + Intergenic
974267320 4:59602326-59602348 TGGAAGTCAAAGAGGAAGCAGGG - Intergenic
974526522 4:63055082-63055104 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
974537099 4:63186864-63186886 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
974838888 4:67280069-67280091 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
975595879 4:76047947-76047969 TTTAAATCAGAGAGGGAGAAGGG + Intronic
976174354 4:82336805-82336827 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
977834957 4:101636038-101636060 TTTAAATCAGAGAGGGAGAAGGG + Intronic
978481226 4:109192915-109192937 GTGAAGACACAGAGAGAGCATGG + Intronic
978747139 4:112207685-112207707 TTTAATTCAGAGAGGGAGAAGGG - Intergenic
979162638 4:117483101-117483123 TAGAGCTTTCAGAGGGAGCATGG - Intergenic
980645591 4:135638410-135638432 TGGAAGTCAAAGGGGGAGCAAGG + Intergenic
982103446 4:151990910-151990932 TTGAATGCACAGAGACAGCAGGG - Intergenic
982372945 4:154654404-154654426 TAGAACTGTCAGAGAGAGCATGG + Intronic
982701087 4:158660217-158660239 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
982873504 4:160614163-160614185 TGGCACCTACAGAGGGAGCAAGG + Intergenic
983834963 4:172374936-172374958 TTTAAATCAGAGAGGGAGAAGGG + Intronic
983999752 4:174225647-174225669 AGGAACTCACAGAGGGAGATGGG - Intergenic
985790639 5:1925307-1925329 TGGAAATCACAGCTGGAGCATGG - Intergenic
986076551 5:4343885-4343907 ATGAACACACAGAGGGAAGAAGG + Intergenic
986933270 5:12853704-12853726 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
988173182 5:27685436-27685458 TAGAGCTTTCAGAGGGAGCATGG - Intergenic
988592057 5:32557626-32557648 TTTAAATCAGAGAGGGAGAAGGG + Intronic
988605538 5:32675747-32675769 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
989578594 5:43011218-43011240 TTGAAATCCCAGAGACAGCAAGG + Intergenic
989957309 5:50372576-50372598 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
990116692 5:52399539-52399561 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
990367912 5:55088940-55088962 TTTAAGTCAGAGAGGGAGAAGGG + Intergenic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991457324 5:66818260-66818282 TTGAACTAAGAGACGGAGAAAGG + Intronic
992545733 5:77812249-77812271 TTTAAATCAGAGAGGGAGAAGGG - Intronic
993155027 5:84211712-84211734 TAGAACCCTCAGAGAGAGCATGG + Intronic
993781022 5:92065471-92065493 TGGAAGACAGAGAGGGAGCATGG - Intergenic
994231775 5:97316029-97316051 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
994960137 5:106589553-106589575 TGTAATTCACAGTGGGAGCAAGG - Intergenic
995029580 5:107464994-107465016 CTGAGCTCACCGAGGAAGCACGG + Intronic
995583464 5:113623567-113623589 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
995781844 5:115784817-115784839 TTGATCTCACAGAGGGAAGGTGG + Intergenic
996680341 5:126223538-126223560 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
997538679 5:134642912-134642934 TGGAAGTCAAAGAGGTAGCAAGG + Intronic
997924539 5:138016829-138016851 TTCAGCTAACAGAGGGAACATGG + Intronic
998322250 5:141243298-141243320 TTGAAATCACAGAGGGAGGTGGG - Intergenic
999050234 5:148515907-148515929 TTGAATTCAGAGAGAGAGAATGG - Intronic
999320909 5:150614476-150614498 CTGACCCCTCAGAGGGAGCAGGG + Intronic
999933188 5:156455974-156455996 GAGAAGTCTCAGAGGGAGCATGG + Intronic
1000055157 5:157599559-157599581 GTAAACTCACAGAGGGGCCATGG + Intergenic
1000085183 5:157882258-157882280 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1001708367 5:173758478-173758500 TTTAACTAAGAGAGGGAGAAGGG + Intergenic
1002394336 5:178941458-178941480 TTGATCCCAGAGAGGGAGGACGG + Intronic
1003805747 6:9724536-9724558 TTTAAATCAGAGAGGGAGAAGGG - Intronic
1003946888 6:11084215-11084237 TAGAGCCCTCAGAGGGAGCATGG + Intergenic
1004281047 6:14280257-14280279 TTGCAGGCAGAGAGGGAGCAAGG + Intergenic
1004812195 6:19273455-19273477 TTTAAATCAGAGAGGGAGAATGG - Intergenic
1005451049 6:25972738-25972760 TAGTCCTTACAGAGGGAGCATGG + Intronic
1005952243 6:30640539-30640561 TTGCCCTCAGAGAGGGAGCAGGG - Exonic
1006221740 6:32497263-32497285 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1006938259 6:37733441-37733463 GTGAACTCACAGGGGCAGTACGG + Intergenic
1007913650 6:45540296-45540318 TTTAAGTCACACAGGCAGCAGGG - Intronic
1008587040 6:52959807-52959829 TTTAAGTCAGAGAGGGAGAAGGG + Intergenic
1009354902 6:62731210-62731232 TTGAAATCAAAGAAGGGGCATGG + Intergenic
1009385984 6:63084558-63084580 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1009407751 6:63330987-63331009 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1009470757 6:64026863-64026885 TTTAAATCAGAGAGGGAGAAGGG - Intronic
1010391885 6:75347089-75347111 TTCAATGCACAGAGGGAGAAAGG - Intronic
1010883677 6:81211076-81211098 TTGAACGCACAGAGAAAGGAGGG + Intergenic
1011375094 6:86679147-86679169 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1011521490 6:88211583-88211605 TTGAACTCCCACAGGGAGACTGG + Intergenic
1011591561 6:88975043-88975065 TAGAGCTGTCAGAGGGAGCACGG + Intergenic
1011774960 6:90719582-90719604 TTTAACTCATAGATGGAGCATGG - Intergenic
1013893771 6:115059336-115059358 CAGAACTCACAGACTGAGCAGGG - Intergenic
1013907896 6:115238908-115238930 TTTAAATCACAGAGGGAGAAGGG + Intergenic
1013977375 6:116093333-116093355 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1014857720 6:126422710-126422732 TCTAACTCACAGAGGAAGTAGGG + Intergenic
1016051711 6:139536939-139536961 TTGAACACACAATGGAAGCAAGG - Intergenic
1016183980 6:141178402-141178424 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1016427356 6:143948801-143948823 TTGAACACACTGAGGGAGGGAGG - Intronic
1016598274 6:145826136-145826158 TGGAAGACAAAGAGGGAGCAGGG - Intergenic
1017912969 6:158810600-158810622 TAGAACACACAGAGAGAGGATGG + Intronic
1018862474 6:167721006-167721028 CTGAACTCACAGCGGGTGCTGGG - Intergenic
1022850344 7:34255413-34255435 TCAGACTCTCAGAGGGAGCATGG + Intergenic
1023078006 7:36502522-36502544 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1023082883 7:36542279-36542301 TGGAGCTTTCAGAGGGAGCATGG + Intronic
1023119163 7:36892205-36892227 TGGCACACACAGAGGGAGGAGGG + Intronic
1024629175 7:51233289-51233311 TTCAACTCACAGAGCCAGCAAGG + Intronic
1024735234 7:52297054-52297076 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1024870837 7:53960450-53960472 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1026729308 7:72897435-72897457 TTGAGATCCAAGAGGGAGCAGGG + Intronic
1027128764 7:75575808-75575830 TTCCACTCACAGAGGGACCGCGG - Intronic
1027467240 7:78531047-78531069 TTGAGTTCCCTGAGGGAGCAGGG - Intronic
1028238608 7:88391530-88391552 TTGAATTCCCAGAGGGAACATGG + Intergenic
1028495272 7:91454085-91454107 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
1028830188 7:95319261-95319283 TTGAACTCACAGGAGGCGGATGG + Intronic
1029042490 7:97592418-97592440 TTGGCCTTACAGAGGGAGTAGGG - Intergenic
1030412864 7:109203628-109203650 TAGCGCCCACAGAGGGAGCATGG + Intergenic
1030456538 7:109781745-109781767 TGGAAGTCACAAAGAGAGCAGGG + Intergenic
1030982353 7:116201019-116201041 TAGAACCCTCAGAGGGAGCATGG + Intergenic
1031192763 7:118575723-118575745 ATGAGGTCAGAGAGGGAGCAGGG + Intergenic
1031350864 7:120729372-120729394 TTAAACTGATAAAGGGAGCAGGG + Intronic
1031731729 7:125310062-125310084 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1032333238 7:130999758-130999780 TTGCTCACACAGAGGCAGCATGG - Intergenic
1033390824 7:140925243-140925265 TTGAAATCCTAGAGGGAGGAAGG + Intergenic
1033759300 7:144422682-144422704 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1034110750 7:148535544-148535566 TTGATGTCACAGAGCGAGTATGG - Intergenic
1034580030 7:152034042-152034064 TTTAAATCAGAGAGGGAGAAAGG + Intronic
1034880997 7:154762539-154762561 TTGAATTCGCAGACTGAGCATGG + Intronic
1034900604 7:154905963-154905985 TAGCACTCTCAGAGGGAGCCTGG - Intergenic
1035826530 8:2650286-2650308 TCCAAGTCTCAGAGGGAGCATGG + Intergenic
1035923582 8:3704369-3704391 AGGAACTCACACAGGGAGGAGGG + Intronic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1038430838 8:27498162-27498184 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1038602932 8:28966079-28966101 TTGAAATCACAGAGGTAAAAAGG - Intronic
1038638734 8:29307219-29307241 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1039275949 8:35934247-35934269 TTTAAGTCAGAGAGGGAGAAGGG - Intergenic
1039421439 8:37445755-37445777 TTGAACTCACAGCGGTGCCATGG + Intergenic
1039693229 8:39883255-39883277 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1040667926 8:49654764-49654786 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1040953335 8:52956883-52956905 TTTAAGTCAGAGAGGGAGAAGGG - Intergenic
1040971515 8:53141315-53141337 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1041774201 8:61506275-61506297 TTAAATTCACAGAGAGAGAAAGG + Intronic
1042161579 8:65902054-65902076 TGGAACTCAGGGAGGGAGCAGGG + Intergenic
1042919558 8:73908254-73908276 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1043257001 8:78149853-78149875 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1044005492 8:86932274-86932296 TTTAAGTCAGAGAGGGAGAAAGG + Intronic
1044364471 8:91326803-91326825 TAGAACCTGCAGAGGGAGCATGG - Intronic
1045555376 8:103209758-103209780 TTGAACTTACTGATTGAGCAGGG - Intronic
1045858494 8:106790798-106790820 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1045935945 8:107678993-107679015 TGAAAGTCTCAGAGGGAGCATGG - Intergenic
1046264829 8:111817136-111817158 TAGAACCTCCAGAGGGAGCATGG + Intergenic
1046961126 8:120114074-120114096 ATACAGTCACAGAGGGAGCAGGG + Intronic
1047199243 8:122750600-122750622 TAGAATTCACAGAGCTAGCAAGG + Intergenic
1047360485 8:124164515-124164537 TTGAATTAACAAAGGGAGGAGGG - Intergenic
1048253148 8:132883923-132883945 TAGAGCTTTCAGAGGGAGCACGG - Intronic
1049232070 8:141489639-141489661 TGGAGCTCAGAGAGGCAGCATGG - Intergenic
1049838151 8:144753751-144753773 TTGATCTCCCAGCTGGAGCAGGG - Exonic
1050133849 9:2441230-2441252 CTGCACTGACAGAGGTAGCAGGG + Intergenic
1050342866 9:4658097-4658119 TTGAAATCAGAGTGTGAGCAGGG - Intronic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1051372008 9:16366747-16366769 TGGAAATCAAAGAGGGGGCATGG - Intergenic
1051651145 9:19326469-19326491 TGAAACTCCCAAAGGGAGCAGGG - Intronic
1052087495 9:24286320-24286342 TTTATCTCACAGACAGAGCACGG + Intergenic
1052348672 9:27435932-27435954 AGGAAGTCACAGAGGGAGCAGGG - Intronic
1053019912 9:34687647-34687669 AGGAACACACAGACGGAGCAGGG - Intergenic
1053228980 9:36389310-36389332 TTGAAAACACAAAGGGAGTATGG + Intronic
1054869874 9:70039411-70039433 AGGAACCCACAGAGAGAGCAGGG + Intergenic
1055315036 9:75026565-75026587 TAGTAGTAACAGAGGGAGCAAGG - Intronic
1055458339 9:76493505-76493527 TTTAAGTCAGAGAGGGAGAAGGG + Intronic
1055690562 9:78826068-78826090 TGGAATTCAAAAAGGGAGCAAGG + Intergenic
1055780161 9:79812124-79812146 TTGAATTCAAATAGGGAGTATGG - Intergenic
1056392840 9:86155035-86155057 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1057551950 9:96057515-96057537 GTGAACTCACAGAGTGAGTGAGG - Intergenic
1058133021 9:101274849-101274871 CTGAACCCACAGAAGGAACATGG - Intronic
1058443095 9:105028599-105028621 TTAAATTCACAAAGGGAGCTTGG + Intergenic
1058669867 9:107351758-107351780 GTGTGCTCACAGAGGGAGGATGG + Intergenic
1062276819 9:135735322-135735344 TTGGACCCCCAGAGGGAGCAGGG + Intronic
1186105996 X:6206581-6206603 AAGAACCCTCAGAGGGAGCATGG - Intronic
1186152945 X:6694604-6694626 TTTAAATCACAGAAGGAGCGTGG - Intergenic
1188097460 X:26042353-26042375 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1188101380 X:26092049-26092071 TTGAACTCACAAGGGCAGGATGG + Intergenic
1188136463 X:26499710-26499732 TTTAAATCAGAGAGGGAGAATGG - Intergenic
1189097245 X:38153632-38153654 ATGAACTAAGAGAGTGAGCAAGG + Intronic
1189607948 X:42699859-42699881 TTGATATCACAGAGGAAGCCTGG + Intergenic
1191205999 X:57834773-57834795 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1192482823 X:71499954-71499976 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1192870074 X:75176513-75176535 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1193295820 X:79830138-79830160 TGGAGCTCCCAGAGGGAGGAGGG - Intergenic
1194305867 X:92247562-92247584 TAGAGCTTTCAGAGGGAGCACGG - Intronic
1195439509 X:104884992-104885014 TTTAAATCAGAGAGGGAGAAGGG - Intronic
1195506537 X:105664610-105664632 TTGAACTCACAGGGGCATCTGGG - Intronic
1195552445 X:106184777-106184799 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1196419446 X:115507386-115507408 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1196488929 X:116245740-116245762 TTTAAATCAGAGAGGGAGAAAGG - Intergenic
1196662003 X:118279681-118279703 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1196827883 X:119755277-119755299 TTTAACTAACTCAGGGAGCATGG - Intergenic
1197513346 X:127397251-127397273 TTTAAATCATAGAGGGAGAAGGG - Intergenic
1197841541 X:130752927-130752949 GAGAACACACAGAAGGAGCAAGG - Intronic
1198306074 X:135384225-135384247 TAGAACCTTCAGAGGGAGCATGG + Intergenic
1198463416 X:136884154-136884176 TTGTACTCCCAGAGGTAGCCAGG + Intergenic
1199074313 X:143511755-143511777 TTGATATCACAGATGGGGCAAGG - Intronic
1199832468 X:151559975-151559997 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1200801078 Y:7387632-7387654 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1200959562 Y:8984450-8984472 TATACCTCACAGAGAGAGCAGGG + Intergenic
1200966714 Y:9045524-9045546 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1201271981 Y:12264455-12264477 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1201429634 Y:13891189-13891211 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1201487522 Y:14508559-14508581 TTTAAGTCAGAGAGGGAGAAGGG - Intergenic
1201496458 Y:14595160-14595182 TTTAAATCAGAGAGGGAGAAGGG + Intronic
1201555677 Y:15262961-15262983 TTTAAGTCAGAGAGGGAGAAGGG - Intergenic
1201636591 Y:16129108-16129130 TTTAACTCCCAGAGAGAGAATGG - Intergenic
1201648947 Y:16264663-16264685 TTTAAGTCAGAGAGGGAGAAGGG + Intergenic
1201653862 Y:16320637-16320659 TTTAAGTCAGAGAGGGAGAAGGG - Intergenic
1201989566 Y:20009245-20009267 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202074752 Y:21026860-21026882 TTTAAATCAGAGAGGGAGAAAGG + Intergenic
1202146745 Y:21806652-21806674 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202192667 Y:22260621-22260643 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202242823 Y:22788391-22788413 TTTAAGTCAGAGAGGGAGAAGGG - Intergenic
1202257769 Y:22939248-22939270 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1202272116 Y:23082688-23082710 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202293910 Y:23337994-23338016 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1202395810 Y:24422141-24422163 TTTAAGTCAGAGAGGGAGAAGGG - Intergenic
1202410759 Y:24572995-24573017 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1202425113 Y:24716432-24716454 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202445676 Y:24953653-24953675 TTTAAATCAGAGAGGGAGAAGGG - Intergenic
1202460022 Y:25097077-25097099 TTTAAATCAGAGAGGGAGAAGGG + Intergenic
1202474975 Y:25247951-25247973 TTTAAGTCAGAGAGGGAGAAGGG + Intergenic