ID: 921713094

View in Genome Browser
Species Human (GRCh38)
Location 1:218392447-218392469
Sequence AAGAGCTACACCACATAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921713094_921713097 6 Left 921713094 1:218392447-218392469 CCCACTTATGTGGTGTAGCTCTT 0: 1
1: 0
2: 0
3: 10
4: 120
Right 921713097 1:218392476-218392498 AGCAGCTGTCAGCCTGAGGTAGG 0: 1
1: 0
2: 7
3: 24
4: 276
921713094_921713100 27 Left 921713094 1:218392447-218392469 CCCACTTATGTGGTGTAGCTCTT 0: 1
1: 0
2: 0
3: 10
4: 120
Right 921713100 1:218392497-218392519 GGGAAGAACTCTTGTACTGTTGG 0: 1
1: 0
2: 0
3: 4
4: 96
921713094_921713096 2 Left 921713094 1:218392447-218392469 CCCACTTATGTGGTGTAGCTCTT 0: 1
1: 0
2: 0
3: 10
4: 120
Right 921713096 1:218392472-218392494 AGAAAGCAGCTGTCAGCCTGAGG 0: 1
1: 1
2: 2
3: 37
4: 345
921713094_921713098 7 Left 921713094 1:218392447-218392469 CCCACTTATGTGGTGTAGCTCTT 0: 1
1: 0
2: 0
3: 10
4: 120
Right 921713098 1:218392477-218392499 GCAGCTGTCAGCCTGAGGTAGGG 0: 1
1: 0
2: 2
3: 15
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921713094 Original CRISPR AAGAGCTACACCACATAAGT GGG (reversed) Intronic
902876428 1:19343404-19343426 GAGAGCTACACCACGGCAGTGGG + Intronic
906119910 1:43382513-43382535 ATGAGGTACACCAGCTAAGTAGG + Intergenic
912578402 1:110697184-110697206 AAGAACTACAATACATAAGAGGG - Intergenic
912587537 1:110780501-110780523 AAAAGCTACACTACATGAGGAGG + Intergenic
915699869 1:157781776-157781798 CAGAGCTCCACCACAGCAGTGGG - Intergenic
916519487 1:165551088-165551110 GAGGGCTACATCACATAATTAGG + Intronic
916790189 1:168118361-168118383 ATGACAAACACCACATAAGTGGG + Intronic
918927294 1:190804775-190804797 AAGAGCAACACTAAATAGGTTGG + Intergenic
920606018 1:207386549-207386571 AAGAGATAGACCACCTAAATAGG + Intergenic
920755745 1:208729493-208729515 AAGTTCTAGACCACATATGTGGG - Intergenic
921713094 1:218392447-218392469 AAGAGCTACACCACATAAGTGGG - Intronic
923350087 1:233096104-233096126 AAGAGATACACCATATATATAGG - Intronic
923966950 1:239152456-239152478 AATATTTACACCACATAAATTGG - Intergenic
924091287 1:240503824-240503846 AATAGCTACACCACATCTATTGG - Intronic
1065368667 10:24959572-24959594 AAGACCTACAACATAGAAGTTGG - Intergenic
1072527019 10:96281148-96281170 AAGATCTGCACCACATTAGCTGG - Intergenic
1074538697 10:114346849-114346871 AAGAGCTTCACCACAGAGGAGGG - Intronic
1077863035 11:6199822-6199844 AAGTGCCAGACCATATAAGTTGG - Exonic
1081332773 11:41825027-41825049 AAGAGTTACTGAACATAAGTGGG + Intergenic
1081709395 11:45207209-45207231 AAGAGCCACACCACGGAAGCTGG - Intronic
1082614350 11:55340173-55340195 AAGAAGTACATCACATAAGCCGG - Intergenic
1084623119 11:70287395-70287417 AAGAGCTGCACCAAATTACTTGG - Intronic
1088215708 11:107506169-107506191 AAGGGCTACATTACAGAAGTAGG + Intronic
1092137103 12:6157672-6157694 AATAGTTACACCACAGAAATTGG + Intergenic
1096782486 12:53999228-53999250 GAGATCTACACAACTTAAGTGGG - Intronic
1099618690 12:84973845-84973867 CAGAGCTTCACCACATGACTAGG + Intergenic
1100082160 12:90865877-90865899 AAGAGCCAAACCATATCAGTTGG - Intergenic
1107793446 13:44026079-44026101 AAGAACTACAAGATATAAGTAGG - Intergenic
1108730223 13:53227709-53227731 AACAGCAACAACACTTAAGTGGG + Intergenic
1113064769 13:106361655-106361677 AAGAGATACACTAGATAAGATGG - Intergenic
1114722828 14:24900567-24900589 AAGCTCTACACCAAATAACTGGG + Intronic
1117224923 14:53646741-53646763 AAGAGCTACACCCCAGAAATAGG - Intergenic
1122347829 14:101071402-101071424 AGGAGCTACACCAAATAAAGTGG - Intergenic
1125133946 15:36319320-36319342 AAGAGATACACCATATAAATGGG - Intergenic
1126508921 15:49443419-49443441 AGCACCTACACCACATAAATTGG + Intronic
1132233409 15:100201144-100201166 CAGAGCCACACCACATCAGAGGG - Intronic
1133501885 16:6374289-6374311 AAGGGTTACACCACACAATTTGG + Intronic
1137461071 16:48664045-48664067 AAGAGGTCCTTCACATAAGTTGG + Intergenic
1141008914 16:80378814-80378836 CAGAGCTAAACCATATCAGTAGG - Intergenic
1203124956 16_KI270728v1_random:1566865-1566887 AAGAGACATACCACATAAGGTGG - Intergenic
1143100794 17:4503658-4503680 AACAGGTACCCCACAGAAGTTGG - Intronic
1144165680 17:12608120-12608142 AAGAACCACACCATATAAGATGG - Intergenic
1144263252 17:13543772-13543794 ATGAGCTACATAACAAAAGTGGG + Intronic
1149041582 17:52196131-52196153 CAGAGCCAAACCATATAAGTGGG - Intergenic
1155465501 18:26130657-26130679 AAGAGCCACAGCCCAGAAGTAGG - Intergenic
1155579870 18:27291610-27291632 CAAAGCTGCACAACATAAGTGGG - Intergenic
1160345963 18:78131905-78131927 AAGGGCTCCACCCCATCAGTTGG - Intergenic
1164213157 19:23117636-23117658 ACAAGCTACACCCCATAACTGGG - Intronic
1165298361 19:34947773-34947795 AATAGCTTCACCAATTAAGTTGG - Intergenic
926625713 2:15088053-15088075 GTGAGCTGCACCACATAAATGGG + Intergenic
926868745 2:17389313-17389335 AAATGCTACACAACATAAGTTGG - Intergenic
928529233 2:32174113-32174135 TAGAACTGCACCACATAAGCAGG - Exonic
930832180 2:55756884-55756906 AAGTGCTACACAGAATAAGTGGG - Intergenic
931545920 2:63387274-63387296 AAAAGCTACCACAAATAAGTAGG + Intronic
932217102 2:69973881-69973903 AATATTTACACCACAGAAGTGGG - Intergenic
935186476 2:100738475-100738497 AATAACTATACCACATAAATGGG + Intergenic
935288372 2:101587174-101587196 AACATCTACACCACAAAAGTAGG - Intergenic
935683504 2:105660273-105660295 AAGCGCAACTCCACAGAAGTAGG - Intergenic
935783629 2:106529936-106529958 CATAGCAAAACCACATAAGTGGG + Intergenic
941663369 2:168218147-168218169 CAGAACTAGACCACATAAATTGG + Intronic
945905726 2:215590680-215590702 AAGATTTACACCACAAAAATTGG - Intergenic
946374694 2:219301022-219301044 AAGGTCTACACAACACAAGTGGG + Intronic
946547056 2:220755671-220755693 AAGAGCTTCACCTGAGAAGTGGG - Intergenic
1169876468 20:10302703-10302725 AAGTCCTACAGCATATAAGTAGG + Intronic
1170756042 20:19208067-19208089 ACCAGCTACACTACATAAGGAGG - Intergenic
1173348365 20:42221978-42222000 CAGAGCCAAACCACATCAGTTGG + Intronic
1173530898 20:43768759-43768781 AAGAGCAAAACCAAACAAGTTGG - Intergenic
1175061366 20:56246931-56246953 AAGAACAACACTACATTAGTAGG + Intergenic
1178974527 21:37209596-37209618 AAGAGCCACACCCCACAAGCTGG + Intergenic
1182976940 22:34631448-34631470 AAGAGCTACACAAAAATAGTGGG + Intergenic
949410126 3:3754542-3754564 AATAGTTACACCACAGAAATGGG - Intronic
949484670 3:4526657-4526679 AAGACCTACACCTCATAGGTGGG - Intronic
950844975 3:16006425-16006447 CAGAGCCAAACCACATCAGTAGG + Intergenic
951423422 3:22514474-22514496 AAGAGCAATACAACAAAAGTTGG + Intergenic
951552688 3:23890589-23890611 AAGAGATACGCTACATAAATTGG + Exonic
953722041 3:45364579-45364601 AATCTCTACACCCCATAAGTTGG + Intergenic
955511224 3:59682377-59682399 AAGAGATACTACAAATAAGTAGG + Intergenic
959784885 3:110284165-110284187 AATAGATACAACACAAAAGTAGG - Intergenic
965185991 3:165464985-165465007 AATAGCTTGACCACATCAGTCGG + Intergenic
967014519 3:185469667-185469689 AACAGCCACAGCTCATAAGTAGG - Intronic
967284647 3:187856753-187856775 AAGAGCTCCCTCACATAAGATGG + Intergenic
970115835 4:12694984-12695006 AACAGCACCCCCACATAAGTTGG + Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
977504274 4:97882093-97882115 ATGAGAAACACCACATAAGCTGG + Intronic
980482182 4:133401219-133401241 AAGAGACACAGCATATAAGTTGG - Intergenic
983092145 4:163516361-163516383 AATAGTTACACCACATAAGGAGG - Intronic
989304855 5:39941955-39941977 TAGAGCTTCAACACATAATTTGG + Intergenic
994570459 5:101507223-101507245 GAGTGCTACAGCACATAAGGCGG - Intergenic
994935784 5:106251678-106251700 AAGAGATATACCATATAAATGGG + Intergenic
996702336 5:126463008-126463030 AAGTGCTTAACCACATAAGGTGG - Intronic
997708992 5:135987229-135987251 AAGGGCTACACCCCAGCAGTAGG - Intergenic
999484369 5:151980446-151980468 AAGTGATACACCACATAAACAGG - Intergenic
1000364688 5:160479839-160479861 CAGAGCAAAACCACCTAAGTTGG + Intergenic
1000500759 5:162046484-162046506 AAGAGCAACATCTCAGAAGTTGG + Intergenic
1003990089 6:11477735-11477757 ATGAGCTACTACAAATAAGTAGG - Intergenic
1004301266 6:14460229-14460251 CAGAGCTAAACCATATCAGTAGG - Intergenic
1007783597 6:44268012-44268034 AAGAGGTAAACCACATAGGGTGG + Intergenic
1009644871 6:66387370-66387392 AATATTTACACCACATAATTTGG - Intergenic
1012146320 6:95687678-95687700 CAGAGCTTTATCACATAAGTAGG + Intergenic
1012654521 6:101798529-101798551 AGGAGCTATACCACATAAAATGG - Intronic
1013747904 6:113367418-113367440 AAGGGATCCCCCACATAAGTGGG + Intergenic
1014415494 6:121178246-121178268 GAGAGCCAAACCACATCAGTAGG + Intronic
1014976802 6:127896500-127896522 AAGAGCTATACCAGATTAGTGGG + Intronic
1015474070 6:133639319-133639341 CAGAGCTAAACCATATCAGTGGG - Intergenic
1017890336 6:158632584-158632606 AAGACCTTCCCCACATGAGTTGG - Exonic
1019133999 6:169897024-169897046 AACAGAGACACCACAGAAGTGGG - Intergenic
1022407227 7:30101778-30101800 AAGAGCTATACCACATTCATGGG + Intronic
1027552823 7:79620243-79620265 AAGAGCTAAACCATATCACTAGG - Intergenic
1031518466 7:122731851-122731873 AATATCTAAACCACCTAAGTTGG - Intronic
1032691252 7:134289450-134289472 AACAGCTACAAGACATTAGTGGG - Exonic
1032750750 7:134838403-134838425 AAGAGCTACAAGAAATAATTTGG + Intronic
1033207001 7:139431641-139431663 AAAAGCTCCACTACATAAGCTGG + Intergenic
1034451812 7:151141231-151141253 AAGAGCTTCACCACATTGCTTGG + Intronic
1035130603 7:156649899-156649921 ATAAGCTTCACCAAATAAGTTGG + Intronic
1037202997 8:16281100-16281122 AAGAGCCACACAACAGAAGAAGG - Intronic
1045179605 8:99766037-99766059 AGGTGCCACACCAAATAAGTAGG - Intronic
1048502054 8:134987270-134987292 CAGAGCCAAACCATATAAGTGGG - Intergenic
1048512357 8:135074377-135074399 GAGATCTACTCCACATAAGTGGG - Intergenic
1052222427 9:26043422-26043444 CAGAGCAACACCACATAAAGTGG - Intergenic
1052262759 9:26537061-26537083 AGGAGATACACCAGAAAAGTTGG + Intergenic
1056680266 9:88711347-88711369 AATAGTTACACCACAGAAATTGG - Intergenic
1058376452 9:104327619-104327641 AACAGCTACACCACAGAAGCAGG + Intergenic
1058544467 9:106045384-106045406 AAGAGCTACACAATGTTAGTAGG + Intergenic
1059723881 9:116987121-116987143 CAGAGCCAAACCACATCAGTAGG - Intronic
1060899129 9:127242059-127242081 AAAAGCGACTCCACACAAGTTGG - Intronic
1185880832 X:3739359-3739381 AAGAATTACACCACTGAAGTAGG - Intergenic
1189003131 X:36966394-36966416 AAGTGCTACACCACAGAGCTAGG - Intergenic
1193215597 X:78860349-78860371 AAAGGCTACAACACATAAATAGG + Intergenic
1197005733 X:121494926-121494948 AATAGCTACACATTATAAGTAGG - Intergenic
1198091752 X:133337852-133337874 AACAGCTACAGCATATATGTAGG + Intronic
1200859628 Y:7976631-7976653 GAGAGTTACACCACTTAAGTGGG + Intergenic