ID: 921714242

View in Genome Browser
Species Human (GRCh38)
Location 1:218401826-218401848
Sequence CTTGATGCCCAGTCGGGACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921714242_921714252 12 Left 921714242 1:218401826-218401848 CCGCGTCCCGACTGGGCATCAAG 0: 1
1: 0
2: 0
3: 7
4: 41
Right 921714252 1:218401861-218401883 GTCTCCCTGCTCCGTGTATAGGG 0: 1
1: 0
2: 0
3: 5
4: 74
921714242_921714256 29 Left 921714242 1:218401826-218401848 CCGCGTCCCGACTGGGCATCAAG 0: 1
1: 0
2: 0
3: 7
4: 41
Right 921714256 1:218401878-218401900 ATAGGGTGTTTATGAAGTAAAGG 0: 1
1: 0
2: 1
3: 12
4: 164
921714242_921714249 -10 Left 921714242 1:218401826-218401848 CCGCGTCCCGACTGGGCATCAAG 0: 1
1: 0
2: 0
3: 7
4: 41
Right 921714249 1:218401839-218401861 GGGCATCAAGGGGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 114
921714242_921714251 11 Left 921714242 1:218401826-218401848 CCGCGTCCCGACTGGGCATCAAG 0: 1
1: 0
2: 0
3: 7
4: 41
Right 921714251 1:218401860-218401882 GGTCTCCCTGCTCCGTGTATAGG 0: 1
1: 0
2: 1
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921714242 Original CRISPR CTTGATGCCCAGTCGGGACG CGG (reversed) Intronic
900165765 1:1243753-1243775 CTTTATGCCCAGACGGAGCGTGG - Intronic
901011784 1:6206415-6206437 CTGGACGCCCAGTCGGGTCCAGG + Intronic
905714137 1:40133456-40133478 CTTGATGCCCAGTCCCGCTGCGG - Intergenic
914800833 1:150961136-150961158 CTTGATGCCTAGTCCTGAGGTGG - Exonic
915958762 1:160246104-160246126 CTTGTTGCCCAGGCTGGATGGGG - Intronic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
1062814034 10:486352-486374 CTTGCTTCCCAGTCGGCAGGAGG - Intronic
1062895582 10:1100909-1100931 CGTGCAGCTCAGTCGGGACGGGG - Intronic
1063128211 10:3154044-3154066 CTGGAGGCCCAGTCGGGGTGTGG - Intronic
1076250160 10:128978879-128978901 ATTGCTGCCCAGTGGGGACAGGG - Intergenic
1081426369 11:42930536-42930558 TTTGATGCCCAGAAGGGAAGGGG + Intergenic
1090360863 11:126171802-126171824 CTTGGTGCCCAGTCAGGATGTGG - Intergenic
1102581671 12:113892387-113892409 ATTGTTGCCCAGTGGGGACTGGG + Intronic
1112421335 13:99252114-99252136 CTGGATGACCAGTTGGGAAGTGG - Intronic
1117918690 14:60705278-60705300 CTTGATACCCAGTAGGGAAGTGG + Intergenic
1123034586 14:105466726-105466748 CTTGATGCCCAGTAGGGGTAAGG + Exonic
1125721385 15:41846769-41846791 CCTGCAGCCCACTCGGGACGTGG + Exonic
1128987445 15:72231434-72231456 CCTGATGACCAATGGGGACGCGG + Intronic
1142854422 17:2721957-2721979 CTGGATGCCCAGGAGGGAAGGGG + Intergenic
1150723028 17:67629424-67629446 CAACATGCCCAGTAGGGACGGGG + Intronic
1163791859 19:19311435-19311457 TTTGATGCCCAGGCTGGGCGCGG + Intronic
925578052 2:5380975-5380997 CTTGTTGCCCAGGCTGGACACGG - Intergenic
926145854 2:10396844-10396866 CTAGTGGCCCAGTCAGGACGCGG + Exonic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
935573571 2:104687298-104687320 CCTGATCCCCAGTGGGGACCTGG + Intergenic
946909554 2:224445975-224445997 CTTGATACCCAGACAGGACAAGG - Intergenic
1169321177 20:4634506-4634528 CTTGATTCCCATTCTGGAAGCGG + Intergenic
1173991210 20:47305039-47305061 CTTGCTGCCCAGGCTGGTCGCGG - Intronic
1175125459 20:56748122-56748144 CTTGTTGCCCAGGCTGGAGGGGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1182359895 22:29740291-29740313 CTTGGTGCCAAGTGGGGACTGGG + Intronic
949606470 3:5659430-5659452 CTTGATGGCCAATCTGGAAGAGG - Intergenic
963030127 3:140962144-140962166 CTTGATGCCAAGTTGGGAAGAGG - Intronic
966083482 3:176036389-176036411 CTTGATGCCAAATCTGGACAGGG + Intergenic
975656413 4:76645447-76645469 CGTGCTGCCCAGGTGGGACGTGG - Intronic
994097352 5:95858954-95858976 GTTGATGAGCAGTCGGGAAGTGG + Exonic
997400861 5:133601119-133601141 GTTCATTCCCAGTGGGGACGTGG - Intronic
998138458 5:139686967-139686989 CCTGAGGCCCAGTCTGGATGGGG + Intergenic
1006665413 6:35689390-35689412 TAAGATGCCCAGTCGGGACTGGG + Intronic
1011597731 6:89032243-89032265 CTTGTTGCCCAGGCTGGAGGGGG + Intergenic
1013117992 6:107116506-107116528 CTTGCTGCCCAGTCGCGGCGAGG + Intergenic
1015429156 6:133110105-133110127 CTTGAAGCCCAGACAGGACAGGG + Intergenic
1018610310 6:165641985-165642007 TTTGACGCCCATTCGGGGCGTGG + Intronic
1024262807 7:47584357-47584379 CTGGATCCCCAATCGGGACCTGG + Intergenic
1037344383 8:17882493-17882515 CTTGATGCCCAGTGGGTAAGCGG + Intronic
1052781464 9:32784627-32784649 CCTGATGCCCATTCTGGACGAGG - Exonic
1052932183 9:34064782-34064804 CTTTATGTCCAGTGGGGAGGAGG - Intergenic
1062221731 9:135419682-135419704 CTTGATGCCCAGTAGGGAGCCGG - Intergenic
1188665512 X:32815137-32815159 CTGGAAACCCAGTCGGGATGGGG + Intronic