ID: 921714249

View in Genome Browser
Species Human (GRCh38)
Location 1:218401839-218401861
Sequence GGGCATCAAGGGGCCTTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921714228_921714249 27 Left 921714228 1:218401789-218401811 CCTACCCCGGGCTCCCTCAGTGG 0: 1
1: 0
2: 3
3: 49
4: 2043
Right 921714249 1:218401839-218401861 GGGCATCAAGGGGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 114
921714242_921714249 -10 Left 921714242 1:218401826-218401848 CCGCGTCCCGACTGGGCATCAAG 0: 1
1: 0
2: 0
3: 7
4: 41
Right 921714249 1:218401839-218401861 GGGCATCAAGGGGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 114
921714234_921714249 21 Left 921714234 1:218401795-218401817 CCGGGCTCCCTCAGTGGAGGGCG 0: 1
1: 0
2: 0
3: 14
4: 179
Right 921714249 1:218401839-218401861 GGGCATCAAGGGGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 114
921714238_921714249 13 Left 921714238 1:218401803-218401825 CCTCAGTGGAGGGCGGGAGCCTG 0: 1
1: 0
2: 0
3: 20
4: 247
Right 921714249 1:218401839-218401861 GGGCATCAAGGGGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 114
921714237_921714249 14 Left 921714237 1:218401802-218401824 CCCTCAGTGGAGGGCGGGAGCCT 0: 1
1: 0
2: 0
3: 9
4: 136
Right 921714249 1:218401839-218401861 GGGCATCAAGGGGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 114
921714227_921714249 28 Left 921714227 1:218401788-218401810 CCCTACCCCGGGCTCCCTCAGTG 0: 1
1: 0
2: 2
3: 25
4: 289
Right 921714249 1:218401839-218401861 GGGCATCAAGGGGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 114
921714241_921714249 -6 Left 921714241 1:218401822-218401844 CCTGCCGCGTCCCGACTGGGCAT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 921714249 1:218401839-218401861 GGGCATCAAGGGGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 114
921714233_921714249 22 Left 921714233 1:218401794-218401816 CCCGGGCTCCCTCAGTGGAGGGC 0: 1
1: 0
2: 3
3: 25
4: 288
Right 921714249 1:218401839-218401861 GGGCATCAAGGGGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 114
921714231_921714249 23 Left 921714231 1:218401793-218401815 CCCCGGGCTCCCTCAGTGGAGGG 0: 1
1: 0
2: 1
3: 71
4: 4543
Right 921714249 1:218401839-218401861 GGGCATCAAGGGGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 114
921714226_921714249 29 Left 921714226 1:218401787-218401809 CCCCTACCCCGGGCTCCCTCAGT 0: 1
1: 0
2: 1
3: 29
4: 327
Right 921714249 1:218401839-218401861 GGGCATCAAGGGGCCTTTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921714249 Original CRISPR GGGCATCAAGGGGCCTTTTT GGG Intronic
900793275 1:4693172-4693194 GGGCAGCATGGGGCCTTCATGGG - Intronic
902893828 1:19464916-19464938 GGGCATGAAGGGACTTTTTAGGG + Intronic
903827951 1:26158772-26158794 GGGGATCAGGAGGCCTTGTTTGG + Intergenic
905958177 1:42017440-42017462 GGGAATTAAGGGGACTTTTAGGG - Intronic
906024719 1:42663812-42663834 AGGAATCAAGGGTCCCTTTTTGG - Intronic
917723966 1:177812360-177812382 GGGCATCAGGGTGCCTGTGTGGG + Intergenic
917907105 1:179596454-179596476 TGGCATGAAGGAGCTTTTTTGGG - Intronic
921714249 1:218401839-218401861 GGGCATCAAGGGGCCTTTTTGGG + Intronic
922875793 1:228938886-228938908 GGGCACCAAGGAGCCTATTTTGG + Intergenic
1073367431 10:102955046-102955068 TGGCAACACGGGCCCTTTTTTGG - Intronic
1074570758 10:114622011-114622033 GGCCATCAAGGAGCAGTTTTAGG - Intronic
1075961630 10:126571970-126571992 GGGCATCAGAAGGCCTTTTGAGG - Intronic
1076358457 10:129869463-129869485 GGACATCTTGGGGCCTTATTAGG + Intronic
1077409790 11:2398624-2398646 AGGTAGCAAGGGCCCTTTTTGGG + Intergenic
1078646705 11:13147456-13147478 GAGCAACAAGGGGACCTTTTTGG + Intergenic
1086985032 11:93238281-93238303 GGGCATGAGGGGGTCTTTTGAGG - Intergenic
1088017353 11:105077147-105077169 AGGCAAGAAGGGGTCTTTTTGGG - Intronic
1088409500 11:109518428-109518450 GGACATCAAGGGACCTTTAGAGG + Intergenic
1089123550 11:116160161-116160183 ATGAATCAAGGGGCCTATTTGGG + Intergenic
1092217425 12:6693186-6693208 TGGGATCAAGGGGTGTTTTTGGG - Intergenic
1093030353 12:14282966-14282988 GGGAAAAAAGGGGCCTTCTTGGG - Intergenic
1094522875 12:31211354-31211376 GGGGATCAAGGGTCATTGTTAGG - Intergenic
1096078175 12:48817834-48817856 GGGCAGAAAGGGGCTGTTTTAGG - Intronic
1105616743 13:22025624-22025646 GGGGAACAAGGGGCCTTCCTGGG + Intergenic
1108441269 13:50455401-50455423 GGGCTTAAAGGGGCTTTTTCAGG + Intronic
1113000123 13:105625533-105625555 GGGCCTCTAGGGCCCTCTTTAGG + Intergenic
1115125938 14:29993863-29993885 GGGCATGAAGGTTTCTTTTTTGG + Intronic
1116473927 14:45317986-45318008 AGGCAAGAAGGGGGCTTTTTTGG + Intergenic
1116930811 14:50688764-50688786 TGGCAGGAAGGGGCCTCTTTTGG + Intergenic
1117495995 14:56304699-56304721 GGGCAGGAAGGGCCCTTGTTTGG - Intergenic
1123508630 15:20972321-20972343 GTGCATCAAGGGGGCTCTTGAGG - Intergenic
1123565851 15:21546070-21546092 GTGCATCAAGGGGGCTCTTGAGG - Intergenic
1123602111 15:21983357-21983379 GTGCATCAAGGGGGCTCTTGAGG - Intergenic
1126644482 15:50861325-50861347 GCTCATTAAGGGGCCATTTTTGG - Intergenic
1129698166 15:77752456-77752478 GGGCAGCAAGAGGCCTTCTCCGG + Intronic
1130308274 15:82730172-82730194 GGGCATCAAGGGGTGTTGCTAGG - Intergenic
1130961137 15:88659356-88659378 AGGCATCAAAGAGACTTTTTGGG + Intergenic
1132373723 15:101314754-101314776 GGACCTCAAGGGGCCTCTTGAGG + Intronic
1202974220 15_KI270727v1_random:273163-273185 GTGCATCAAGGGGGCTCTTGAGG - Intergenic
1138018890 16:53458524-53458546 CTGCATCAAGTTGCCTTTTTAGG + Intronic
1140981477 16:80113621-80113643 GGGGAGGATGGGGCCTTTTTGGG + Intergenic
1142329516 16:89442464-89442486 GTGCATAAAGGGGCGTTTGTGGG - Intronic
1143399465 17:6633904-6633926 GGGCATCAAGAGAACTTTCTAGG + Intronic
1143782869 17:9238539-9238561 GAGCCTCATGGGGCCTTCTTGGG - Intronic
1143941585 17:10547818-10547840 TGGCATCAAAGGGCCTATTCTGG + Exonic
1145830544 17:27912849-27912871 GGGCAGGAACGGGCTTTTTTAGG - Intergenic
1150915547 17:69433018-69433040 GAGCATCAATGTGCCTTTTCTGG - Intronic
1151537193 17:74745646-74745668 GGGGATCCAGGCGCCTTTTTTGG - Exonic
1152334268 17:79691565-79691587 CGGCATCATGTGGCCTCTTTGGG - Intergenic
1153208457 18:2731465-2731487 GGGCATCTAGAGGCCTTCTCTGG + Intronic
1162823446 19:13236879-13236901 GGGCTTCAAGGGACCTTGGTGGG + Intronic
1163043722 19:14623572-14623594 GGGAATCATGGGACCTTTCTGGG - Intronic
1167278641 19:48553670-48553692 GGGCATGAAGAGGCCTTCCTGGG + Intronic
927250122 2:20989475-20989497 GGGCCTCTGGGAGCCTTTTTGGG + Intergenic
927558914 2:24055126-24055148 AGGCATCAGGGGGACTTTTGGGG - Intronic
935867654 2:107408354-107408376 GGGCACCATGGGGCATTTTCGGG + Intergenic
936746548 2:115583429-115583451 AGGCACCAAGAGGCCTTCTTGGG - Intronic
945127502 2:206528990-206529012 GGGCATCTAGGTTCCTGTTTGGG - Intronic
946147043 2:217738868-217738890 GGGCAGCAAGAGGCCTTCTGAGG + Intronic
947893067 2:233643514-233643536 GAGCATCAAGAGGGCTTTTGGGG - Intronic
948367532 2:237467158-237467180 GGGCACGAGGGGACCTTTTTGGG - Intergenic
1169931617 20:10839174-10839196 GAGCATCCAGGGACATTTTTTGG + Intergenic
1175741326 20:61421541-61421563 CGGAATCAAGGGGCCTTCTGGGG + Intronic
1179419699 21:41225622-41225644 GGGCATAAAGGAACCTTTTGAGG + Intronic
1181672548 22:24432470-24432492 GGGCAGGGAGGGGCCTTTCTGGG + Intronic
1183965558 22:41439811-41439833 CGGCCTTAAGGGGCATTTTTGGG + Intronic
952880496 3:37982932-37982954 TGGCATCACAGGGCCTTATTTGG + Exonic
953625809 3:44569997-44570019 GGACATCAGGGGGACTCTTTGGG + Exonic
954858735 3:53669419-53669441 GGGCATAAAGGGGACATCTTGGG + Intronic
958876618 3:99624411-99624433 AGGAAGGAAGGGGCCTTTTTTGG - Intergenic
960347299 3:116549481-116549503 GGGCATGAGGGGACCTTTGTGGG + Intronic
961043156 3:123691718-123691740 GGGCTTCAAGATGCCTTATTTGG + Intronic
967892035 3:194370440-194370462 GGCAATCAAGGGGCATATTTGGG + Intergenic
972353202 4:38256789-38256811 GGGGTTCAAGGGGACTTTTTGGG + Intergenic
979304296 4:119124773-119124795 GGGGCTCAAGAGGCCTCTTTAGG - Intergenic
981007352 4:139889546-139889568 CGGCATCAAGGGGTTTTTGTTGG + Exonic
984548489 4:181133670-181133692 GGGCAGCAAGGGTCCTGCTTGGG + Intergenic
988659570 5:33250744-33250766 GCCCATCAAGAGGCATTTTTAGG + Intergenic
989431053 5:41355906-41355928 GGGCATCAAATGGCCTCCTTTGG + Intronic
990546481 5:56826965-56826987 AGGCATCAGGAGGCTTTTTTGGG + Intronic
992228734 5:74642619-74642641 GGTCATCTAGGTGCCGTTTTAGG - Intronic
993984005 5:94575021-94575043 GGGCATCAATGGAACTGTTTTGG + Intronic
996139991 5:119895338-119895360 GGGGAACTAGGGGCCATTTTGGG - Intergenic
996846959 5:127910625-127910647 GGGAAACAATGGGACTTTTTGGG - Intergenic
996931636 5:128896227-128896249 GGGCACCAAGAGGCCTCTTGAGG - Intronic
998156265 5:139788659-139788681 CGGCATCTAAGGGCCTTTGTGGG - Intergenic
1001756246 5:174172547-174172569 GAGCATCTAGGGCCCTCTTTGGG + Intronic
1003367551 6:5490021-5490043 GGGCCACAAGGAGGCTTTTTAGG - Intronic
1012859710 6:104544735-104544757 TGGCATCAAGGGTCCTTGTCAGG + Intergenic
1014280096 6:119432593-119432615 GGGCATCTGGGGATCTTTTTTGG + Intergenic
1016121966 6:140355090-140355112 GGACATCAGAGGGCATTTTTTGG + Intergenic
1016837382 6:148491895-148491917 GGTTATCAATGTGCCTTTTTGGG + Intronic
1017316024 6:153032325-153032347 GGGCAACATGGGGTATTTTTAGG - Intronic
1019554866 7:1624169-1624191 GGGCATCTAGGGGCCTGGGTGGG + Intergenic
1022522602 7:31017702-31017724 GGGCACTAAGGGGCCTTCCTGGG - Intergenic
1024202723 7:47122792-47122814 AGGCACCAAGGGGCCTATTGTGG + Intergenic
1025800264 7:64780215-64780237 GAGCACCAAGTGGGCTTTTTGGG - Intergenic
1026982215 7:74533468-74533490 GGGCACCCAGGGGCCCATTTAGG - Intronic
1027954802 7:84864417-84864439 GGTAACCAAGGGGCCTTTATTGG + Intergenic
1030057286 7:105594437-105594459 GTGCATCATGGGGCCTTTATGGG + Intronic
1030403443 7:109081494-109081516 TGGTATCAAGGGGCTTTTTTGGG - Intergenic
1032821117 7:135525491-135525513 GGCAAGCAAGTGGCCTTTTTGGG - Intergenic
1033459119 7:141529400-141529422 GGACTTCAATGGGTCTTTTTGGG + Intergenic
1038937466 8:32268083-32268105 AGGCACCAAGGGGCCATATTGGG + Intronic
1040294547 8:46142420-46142442 GGGATTGAAGGGGCCTGTTTGGG + Intergenic
1045463394 8:102446569-102446591 GGGCATCAAGGGGCCCTCTAGGG - Intergenic
1048898450 8:139015814-139015836 GGGCATCTATGCGCCTTATTTGG + Intergenic
1052258779 9:26491048-26491070 GAGCATCAAGCGGCCTCTTGGGG - Intergenic
1052830900 9:33214619-33214641 GGTAATCAAGGGGCTTTTTGGGG - Intergenic
1053304899 9:36977470-36977492 GGGCTACAGGGGGCCTTTCTTGG - Intronic
1057592467 9:96384083-96384105 GGGCAGCAAGGGGAATTTTTGGG - Intergenic
1058979080 9:110152521-110152543 GGACTTCAAGGGGCCTTATGGGG + Intronic
1062261458 9:135665137-135665159 GGGGGTCAAGTGGCCTTTTGAGG - Intronic
1203760498 EBV:10763-10785 GGGCATCTGGGGGCCCTTGTTGG - Intergenic
1185643027 X:1598823-1598845 GTGCATCCCGGGGCCTTGTTGGG + Intronic
1187683912 X:21797557-21797579 GGGCATGAAGGAGCCTTCTGAGG + Intergenic
1189376449 X:40470255-40470277 GGGCAAGAAGAGGGCTTTTTGGG - Intergenic
1190502729 X:51095670-51095692 GGGCCCCAAGGGGGCTTTCTGGG - Intergenic
1194595097 X:95847872-95847894 TGGAAGGAAGGGGCCTTTTTTGG - Intergenic
1195115690 X:101696093-101696115 TGGAATGAAGGGGTCTTTTTTGG - Intergenic
1198213043 X:134532912-134532934 AGGCAAGAAGGGGTCTTTTTGGG - Intergenic
1198215086 X:134548415-134548437 GGGGATCGAGGTGGCTTTTTAGG - Intergenic
1199173560 X:144758504-144758526 GAGCATCAAGGGGGCTTTTAGGG + Intergenic