ID: 921714251

View in Genome Browser
Species Human (GRCh38)
Location 1:218401860-218401882
Sequence GGTCTCCCTGCTCCGTGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921714246_921714251 5 Left 921714246 1:218401832-218401854 CCCGACTGGGCATCAAGGGGCCT 0: 1
1: 0
2: 1
3: 7
4: 144
Right 921714251 1:218401860-218401882 GGTCTCCCTGCTCCGTGTATAGG 0: 1
1: 0
2: 1
3: 6
4: 83
921714241_921714251 15 Left 921714241 1:218401822-218401844 CCTGCCGCGTCCCGACTGGGCAT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 921714251 1:218401860-218401882 GGTCTCCCTGCTCCGTGTATAGG 0: 1
1: 0
2: 1
3: 6
4: 83
921714247_921714251 4 Left 921714247 1:218401833-218401855 CCGACTGGGCATCAAGGGGCCTT 0: 1
1: 0
2: 0
3: 15
4: 92
Right 921714251 1:218401860-218401882 GGTCTCCCTGCTCCGTGTATAGG 0: 1
1: 0
2: 1
3: 6
4: 83
921714242_921714251 11 Left 921714242 1:218401826-218401848 CCGCGTCCCGACTGGGCATCAAG 0: 1
1: 0
2: 0
3: 7
4: 41
Right 921714251 1:218401860-218401882 GGTCTCCCTGCTCCGTGTATAGG 0: 1
1: 0
2: 1
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921714251 Original CRISPR GGTCTCCCTGCTCCGTGTAT AGG Intronic
906177921 1:43791932-43791954 GGTCTCCTGGCTCAGTGGATGGG + Intronic
906540596 1:46582964-46582986 GGTCTTCCTGCTCCCTGAAAAGG + Intronic
908903681 1:68984450-68984472 GGGCTCCCTGCTCAGGATATCGG + Intergenic
909267307 1:73577138-73577160 GGTCTCTCTGCTTCATGTCTAGG + Intergenic
920347558 1:205316466-205316488 GGTTTCCCTGCTCCTCCTATGGG - Intronic
921714251 1:218401860-218401882 GGTCTCCCTGCTCCGTGTATAGG + Intronic
923731689 1:236557266-236557288 GGTCTACCTGCTCAGTGCCTTGG - Exonic
924694764 1:246387603-246387625 GGTCTCTCTGCTCTGTGTTCTGG - Intronic
1067077361 10:43195788-43195810 GGTCTTCCTGCTCTGTGGTTTGG - Exonic
1074733077 10:116398142-116398164 GGTCTCACTGCTCTGTGCAATGG + Intergenic
1075929997 10:126287929-126287951 GGTGGCCCTGCTCCGGGTGTGGG - Intronic
1075930059 10:126288202-126288224 GGTTTCCCTGCTCCTTGTACAGG - Intronic
1077159247 11:1105196-1105218 GGTCACCCTCCTCCGTGTGTGGG + Intergenic
1077294100 11:1816049-1816071 GGTCTCCCAGACCCGTGTCTGGG + Intergenic
1084007844 11:66332584-66332606 GGTAGCCCTGCTCCTTGTACAGG + Exonic
1102629290 12:114263315-114263337 GGAATCCCTGCTCCCTGGATTGG + Intergenic
1104731222 12:131106509-131106531 GGGCTGCCTGCTCCATGTGTGGG + Intronic
1104806389 12:131592103-131592125 GGTGTCCCTGCACCCTGTGTGGG - Intergenic
1104826343 12:131711844-131711866 GCTCTCACTGCTCGGTGTACTGG + Intronic
1108944412 13:56003113-56003135 GGTCCCCCTGCTCTGTGCAGTGG - Intergenic
1109646463 13:65264538-65264560 GGTTTCCCAGCTCCATGTCTCGG + Intergenic
1114918917 14:27301886-27301908 GGTCTCCCTTCTCTGTCAATGGG + Intergenic
1116541817 14:46109412-46109434 GGTCTACATGCTCCTTCTATGGG - Intergenic
1122353990 14:101112610-101112632 GCTCTCCCTGCTCCCTGAAGAGG - Intergenic
1125383897 15:39115684-39115706 GGTTTCCCAGCTCCATGTGTAGG + Intergenic
1125738390 15:41944160-41944182 GGCCTCCCTGCTCTGGGTCTTGG + Intronic
1130843014 15:87719402-87719424 GCTCTCCCTTCTCCCTGTACTGG + Intergenic
1132971816 16:2692946-2692968 GGCCTGCCTGCTCCGTGGAGCGG + Intronic
1137449340 16:48556343-48556365 TGTCTGCCTGCTCAGGGTATAGG - Intronic
1141783425 16:86181266-86181288 AGTCTCCATGTTCTGTGTATGGG - Intergenic
1141998143 16:87647991-87648013 GGGCTCCCTGCTCCCTGTAGTGG + Intronic
1142076417 16:88120615-88120637 GGTCTGCATGCTCCGTGGACAGG - Intergenic
1147647154 17:42040649-42040671 GGCCTCCCTGCTGCCTGTAGTGG - Intronic
1148350075 17:46934953-46934975 GGTCTCACTGCTCTGTCTTTTGG - Intronic
1152844747 17:82592935-82592957 GGTCTCCCTGCGCCGGGCACAGG + Intronic
1152844774 17:82593085-82593107 GGTCTCCCTGCGCCGGGCACAGG + Intronic
1152844784 17:82593136-82593158 GGTCTCCCTGCACCGGGCACAGG + Intronic
1159320293 18:66839135-66839157 GGTCTCCCAGCTCCATGCCTAGG + Intergenic
1160704725 19:524607-524629 GGTCTCAGTGCTCAGTGGATCGG - Intergenic
1161028324 19:2046731-2046753 GGTCTCCCTGCTGCGTGGGCAGG - Intronic
1166258450 19:41621585-41621607 GGTCTCCCTCCTCCCTGACTGGG + Intronic
1166276642 19:41758560-41758582 GGTCTCCCTGGTCCTGGTCTGGG + Intronic
926608435 2:14921210-14921232 GTTCTGACTGCTCCATGTATTGG - Intergenic
937980417 2:127611499-127611521 GGGCTCACTGCTCTGTGTCTGGG - Intronic
1172096834 20:32464478-32464500 GGGCTCCCTGCTCCGTGGCTGGG - Intronic
1174084722 20:47998816-47998838 GCTCTCCCTGCTCCGTCCCTTGG - Intergenic
1174260199 20:49288892-49288914 AGTTTCCCAGCTCCGTTTATCGG + Intergenic
1174296004 20:49545671-49545693 GGCCTCTCTGCTCCTTGTGTAGG + Intronic
1175237626 20:57525341-57525363 GGTCTCCCAGTGCCCTGTATGGG - Intronic
1178937374 21:36875073-36875095 GGTCTCCCTCCTGCGTTCATTGG - Intronic
1180262257 21:46680123-46680145 GATCTCCCTGCTCAGTAAATTGG - Intergenic
949942381 3:9164950-9164972 TGTTTCCCTGCTCCGTCTCTGGG + Intronic
950979154 3:17283281-17283303 GTTCACCCTGCTGCGTTTATTGG - Intronic
951601212 3:24377787-24377809 GGTCTCTCTTCTCAGTGTACAGG - Intronic
952286808 3:31977362-31977384 GGTCTCCCTGCTTCATGCTTTGG + Intronic
954303969 3:49715905-49715927 GGTCAGCCTGCTGCGTGTCTTGG + Exonic
960880181 3:122336203-122336225 GGAGTCCCTGCTCCTTTTATTGG - Intronic
963906565 3:150778547-150778569 GGTCTCCCCGCTCGGTCTTTGGG + Intergenic
966376826 3:179304812-179304834 ACTCTCCCTGCCCCGTGGATGGG - Intergenic
968107825 3:196014766-196014788 GATCTCCCTGCTCAGTAAATTGG + Intergenic
968495405 4:912458-912480 GGTCTCCCTGCCCAGTGGATGGG - Intronic
975140731 4:70915807-70915829 TGTCTCCCTGCTCTGTCTAGTGG + Intronic
975557186 4:75676232-75676254 GGTCTCCCTGCCTAGTCTATAGG - Intronic
977300098 4:95257572-95257594 TGTATCCCTGCTCCGTAAATGGG - Intronic
981471752 4:145143299-145143321 GGTTTCTGTGCTCTGTGTATAGG - Intronic
985469761 5:32833-32855 GATCTCCCTGCTCAGTAAATTGG + Intergenic
988821899 5:34895560-34895582 GTTCTCCCTGCTCCTTCTGTTGG - Intronic
992751988 5:79870441-79870463 GGTCTCCCTCCACCATGTCTGGG - Intergenic
997690367 5:135824032-135824054 GGTCTGCCTGCTTCATGTGTGGG - Intergenic
999541931 5:152584080-152584102 TCTCTCCATGCTCTGTGTATGGG + Intergenic
1000331453 5:160209061-160209083 GGTCTCCCTGCTGGGTGCAGTGG - Intronic
1002315137 5:178338547-178338569 GGTCACCCAGCACCGGGTATGGG + Intronic
1003602125 6:7527049-7527071 GGTCTCCGTGCACCGTGGAGGGG - Intergenic
1006047868 6:31313134-31313156 ACTCTCCCTGCTCCGTGTCCTGG - Intronic
1016807039 6:148222091-148222113 GGTCTCCCTGGTCAATGTGTGGG + Intergenic
1019605683 7:1909080-1909102 GGTCCCGCTGCTCCGAGTCTGGG - Intronic
1019783674 7:2959649-2959671 GGCCTCCCTGCTCTGTGGCTGGG + Intronic
1031353571 7:120763793-120763815 GGTCTCCCTGTTCCGTCCATGGG + Intergenic
1031904670 7:127447307-127447329 GGTTTCCCTGCTCCATGCCTAGG + Intergenic
1035488702 7:159253077-159253099 GGTCTCCCAGCAGAGTGTATCGG + Intergenic
1037449388 8:19001552-19001574 GGTCTCGCTGCTCGGTGCAAAGG + Intronic
1043034558 8:75179421-75179443 GGTTTCCCAGCTCCATGCATAGG + Intergenic
1045951174 8:107853353-107853375 GGTCTCCCTGCTCTGTGTCTTGG - Intergenic
1046998705 8:120552303-120552325 GCTCTCCCTGTTCAGGGTATTGG - Intronic
1047864343 8:129005298-129005320 GGGCTCCGTGCTGCCTGTATGGG + Intergenic
1049021625 8:139961201-139961223 GCTATCCCTGCTCTGTGTAGTGG - Intronic
1059460452 9:114426228-114426250 GGTCTCCCTGATCCGGGAACTGG + Exonic
1187400412 X:18954502-18954524 GGTCTCCCTGCTCCAGGTCCCGG - Intronic
1198280552 X:135138003-135138025 GGTCACCCTGCTTCATGTTTTGG - Intergenic
1198290407 X:135234511-135234533 GGTCACCCTGCTTCATGTTTTGG + Intergenic
1199237195 X:145505411-145505433 TGTCTCCCAGCTCTGTGAATAGG + Intergenic