ID: 921714252

View in Genome Browser
Species Human (GRCh38)
Location 1:218401861-218401883
Sequence GTCTCCCTGCTCCGTGTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921714241_921714252 16 Left 921714241 1:218401822-218401844 CCTGCCGCGTCCCGACTGGGCAT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 921714252 1:218401861-218401883 GTCTCCCTGCTCCGTGTATAGGG 0: 1
1: 0
2: 0
3: 5
4: 74
921714247_921714252 5 Left 921714247 1:218401833-218401855 CCGACTGGGCATCAAGGGGCCTT 0: 1
1: 0
2: 0
3: 15
4: 92
Right 921714252 1:218401861-218401883 GTCTCCCTGCTCCGTGTATAGGG 0: 1
1: 0
2: 0
3: 5
4: 74
921714246_921714252 6 Left 921714246 1:218401832-218401854 CCCGACTGGGCATCAAGGGGCCT 0: 1
1: 0
2: 1
3: 7
4: 144
Right 921714252 1:218401861-218401883 GTCTCCCTGCTCCGTGTATAGGG 0: 1
1: 0
2: 0
3: 5
4: 74
921714242_921714252 12 Left 921714242 1:218401826-218401848 CCGCGTCCCGACTGGGCATCAAG 0: 1
1: 0
2: 0
3: 7
4: 41
Right 921714252 1:218401861-218401883 GTCTCCCTGCTCCGTGTATAGGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921714252 Original CRISPR GTCTCCCTGCTCCGTGTATA GGG Intronic
904965351 1:34368574-34368596 GCCTCCCTCTTCTGTGTATAAGG + Intergenic
915859698 1:159431090-159431112 GTCTCCCCGTTCCGTGTGGAGGG - Intergenic
921359090 1:214313840-214313862 GTTTCCCTGCCCCGGGTAGAGGG - Intronic
921714252 1:218401861-218401883 GTCTCCCTGCTCCGTGTATAGGG + Intronic
1064511161 10:16093766-16093788 GTCTCCCTCCTCTGTGTAGCAGG - Intergenic
1073950382 10:108801912-108801934 GTCTCTCTTCTCCCTGTATCAGG + Intergenic
1075686131 10:124366607-124366629 CTCTCCCTGCTCCTTGAATTAGG - Intergenic
1075930058 10:126288201-126288223 GTTTCCCTGCTCCTTGTACAGGG - Intronic
1077159248 11:1105197-1105219 GTCACCCTCCTCCGTGTGTGGGG + Intergenic
1077235984 11:1482208-1482230 GTCTCCCTGCTCTGTGTCTTAGG + Intronic
1077639344 11:3867396-3867418 GTCTTCCTGCTCCCTGTCTTTGG + Intronic
1084586359 11:70065049-70065071 GTCCCCCTGCTCCCTGTACCTGG - Intergenic
1085196422 11:74674798-74674820 GTCTCCCTCCTCAGTTCATAAGG + Intergenic
1089610429 11:119665591-119665613 GTCTCACTGCACCATGAATAGGG - Intronic
1104934509 12:132357371-132357393 GGGTCCCTGCTCCGTGCATCTGG + Intergenic
1118697985 14:68403608-68403630 GTCTCTCTGCTCTGTATACATGG - Intronic
1130048765 15:80466083-80466105 GTCTGCTTGCTCCGGGTCTAAGG + Intronic
1131937419 15:97522122-97522144 GTCTCCCTGCACAGTGTCTGTGG - Intergenic
1132353344 15:101154301-101154323 GTCCCCCTGCCCCGTGACTACGG + Intergenic
1134118254 16:11565637-11565659 GACTCCCTGCTCCGGGTTTGTGG + Intronic
1141783424 16:86181265-86181287 GTCTCCATGTTCTGTGTATGGGG - Intergenic
1142076416 16:88120614-88120636 GTCTGCATGCTCCGTGGACAGGG - Intergenic
1148211542 17:45811584-45811606 GTCTACCTGCCCCGTGAATGAGG + Intronic
1149397788 17:56262441-56262463 GTTTCCCTGCTCTGTTTTTAAGG + Intronic
1151562891 17:74880148-74880170 GTCTCCCTGCTCCCTGCCCAGGG - Intronic
1151830383 17:76545884-76545906 GTCGCCCAGCTCTGTGTATGTGG - Intronic
1155082069 18:22420218-22420240 CTTTCCCTGCTCTGTGTCTATGG - Intergenic
1157572834 18:48724317-48724339 GACCCCCTGCTCCTTGTAGATGG + Intronic
1160687059 19:441980-442002 CTCTCCCTGCTCCAGGTACATGG - Intronic
1161028323 19:2046730-2046752 GTCTCCCTGCTGCGTGGGCAGGG - Intronic
1162933408 19:13968507-13968529 GCCTCCCTGCCCCGTGCAGACGG - Intronic
1164521538 19:28983714-28983736 GCCTCCCTGCTGGGAGTATATGG + Intergenic
1168691132 19:58378213-58378235 TGCTCCCTCCTCCGTGTAAAGGG - Intronic
929636270 2:43524843-43524865 GTCTCCCCGCTCCATTTATTCGG + Intronic
932309317 2:70727141-70727163 GTCTTCCTGCTCCGAGTCTATGG - Intronic
933243342 2:79947677-79947699 ATCTCCCTGCACCCAGTATATGG - Intronic
934766965 2:96885119-96885141 TCATCCCTGCTCCGTGTTTAGGG - Intronic
934845978 2:97661552-97661574 CTCTTCCTGCTCCGAGTTTAGGG + Intronic
935459084 2:103307481-103307503 GCCTCCCTCCTCCATGTGTAAGG + Intergenic
936592638 2:113818650-113818672 GTCTCCCTCCTCCCCGCATAAGG - Intergenic
944534189 2:200693752-200693774 GTCTCCTTGCTCCTTGGAGATGG + Intergenic
947145080 2:227056978-227057000 GCCTCCCTGCACCTTGTATTAGG + Intronic
947787958 2:232841654-232841676 GTCTCCCTGTACCCTTTATAAGG + Intronic
1172096833 20:32464477-32464499 GGCTCCCTGCTCCGTGGCTGGGG - Intronic
1174631245 20:51959902-51959924 CTTTCCCTGCTCTGTGTAAATGG + Intergenic
1177296429 21:19182239-19182261 TTCTCCCTTCTCAGTGTTTATGG + Intergenic
1178150820 21:29791460-29791482 CTCTCCCTGCTTCATGTATGTGG - Intronic
1180137976 21:45873516-45873538 GCCTCCCAGCTCTGTGTAAATGG + Intronic
1181053989 22:20251106-20251128 CTCTCCCTGCACCTTGTATCAGG + Intronic
1183664274 22:39238358-39238380 GTCTCCCTGCTCAGATTAAAAGG - Intronic
951601211 3:24377786-24377808 GTCTCTCTTCTCAGTGTACAGGG - Intronic
953316987 3:41937611-41937633 GTCACCTTTCTCCCTGTATATGG + Intronic
957503821 3:81093726-81093748 GTCTCTCTACTCCTTGTGTATGG - Intergenic
966406180 3:179600750-179600772 GTGTCCCTGCTCCATCTAGAAGG + Intronic
977014846 4:91679165-91679187 ATCTCCATGCTCCGTGTTTGAGG - Intergenic
981471751 4:145143298-145143320 GTTTCTGTGCTCTGTGTATAGGG - Intronic
991700987 5:69316344-69316366 GTCTCCCTCTTTCATGTATAAGG - Intronic
993148523 5:84128603-84128625 GTCCCCCTGCTCCTTTTGTAAGG + Intronic
1005216054 6:23529586-23529608 TTCTCCCTGGGCCCTGTATACGG - Intergenic
1006000108 6:30957846-30957868 GTCTCCTTGCTCCCTTTTTATGG - Intergenic
1007277573 6:40686493-40686515 ATTTCCCTGCTCAGTGTTTAGGG - Intergenic
1007779736 6:44246129-44246151 GTCCCCGTGCTCCGTGTACGTGG + Intergenic
1013577715 6:111501256-111501278 GTTTCTCTGCTCCTTGAATACGG - Intergenic
1016474292 6:144409643-144409665 GTCTCCTTGCTCTGTGTAATAGG - Intronic
1017199254 6:151734589-151734611 ATCTTGCTGCTCCCTGTATAAGG + Intronic
1026518222 7:71091330-71091352 TCCTCCCTGCTCAGTTTATATGG - Intergenic
1026960283 7:74403664-74403686 GTCTCCCTGCTGTGTGTTTGTGG - Intronic
1028618112 7:92793126-92793148 GTCTTCCTGATCCATGAATACGG - Intronic
1029064469 7:97835425-97835447 CTGTCCCTGCTTCGTGTGTAAGG - Intergenic
1031698595 7:124893820-124893842 GTCTCCCTGCGCTGTCTTTAAGG - Intronic
1033134570 7:138773876-138773898 GGCTCCCTGCTCCGTGCGTCAGG - Intronic
1036639068 8:10570845-10570867 GGGACCCTGCTTCGTGTATATGG + Intergenic
1036963731 8:13273594-13273616 GGCTCCCTGTTTCGTGTAGAAGG + Intronic
1045951173 8:107853352-107853374 GTCTCCCTGCTCTGTGTCTTGGG - Intergenic
1059391302 9:114001241-114001263 GTCTCCCTGCTCCTGGGAGAAGG + Intronic
1186472181 X:9830325-9830347 CTCCCCCTGCTCCGTGTACATGG - Intronic
1190335989 X:49261901-49261923 CTCTCCGTGCTCAGTGTAGAAGG - Intronic
1202246745 Y:22827987-22828009 GTCATCATGCTCAGTGTATACGG - Intergenic
1202399734 Y:24461735-24461757 GTCATCATGCTCAGTGTATACGG - Intergenic
1202471046 Y:25208351-25208373 GTCATCATGCTCAGTGTATACGG + Intergenic