ID: 921714256

View in Genome Browser
Species Human (GRCh38)
Location 1:218401878-218401900
Sequence ATAGGGTGTTTATGAAGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921714247_921714256 22 Left 921714247 1:218401833-218401855 CCGACTGGGCATCAAGGGGCCTT 0: 1
1: 0
2: 0
3: 15
4: 92
Right 921714256 1:218401878-218401900 ATAGGGTGTTTATGAAGTAAAGG 0: 1
1: 0
2: 1
3: 12
4: 164
921714253_921714256 -10 Left 921714253 1:218401865-218401887 CCCTGCTCCGTGTATAGGGTGTT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 921714256 1:218401878-218401900 ATAGGGTGTTTATGAAGTAAAGG 0: 1
1: 0
2: 1
3: 12
4: 164
921714246_921714256 23 Left 921714246 1:218401832-218401854 CCCGACTGGGCATCAAGGGGCCT 0: 1
1: 0
2: 1
3: 7
4: 144
Right 921714256 1:218401878-218401900 ATAGGGTGTTTATGAAGTAAAGG 0: 1
1: 0
2: 1
3: 12
4: 164
921714242_921714256 29 Left 921714242 1:218401826-218401848 CCGCGTCCCGACTGGGCATCAAG 0: 1
1: 0
2: 0
3: 7
4: 41
Right 921714256 1:218401878-218401900 ATAGGGTGTTTATGAAGTAAAGG 0: 1
1: 0
2: 1
3: 12
4: 164
921714250_921714256 3 Left 921714250 1:218401852-218401874 CCTTTTTGGGTCTCCCTGCTCCG 0: 1
1: 0
2: 1
3: 7
4: 147
Right 921714256 1:218401878-218401900 ATAGGGTGTTTATGAAGTAAAGG 0: 1
1: 0
2: 1
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921714256 Original CRISPR ATAGGGTGTTTATGAAGTAA AGG Intronic
902234907 1:15051004-15051026 AGAGTGTGTTTATGAAGCACGGG + Intronic
908051247 1:60233739-60233761 TTATGGTGTTTTTGAATTAATGG - Intergenic
908693762 1:66813075-66813097 AAATGGAGTTTATGAAGCAATGG + Exonic
909417297 1:75421301-75421323 ATAGGGTGTCTTTAAAATAATGG - Intronic
910841594 1:91566969-91566991 ATTGGGTGTTTATTACGTATAGG + Intergenic
912739739 1:112182984-112183006 ATATGGTTTTTAGGAGGTAATGG + Intergenic
913540613 1:119816777-119816799 ATAGGTTGTTCATGAAGTGGTGG - Intergenic
915148291 1:153808672-153808694 CCAGGCTGTTTTTGAAGTAAGGG - Exonic
916499952 1:165377917-165377939 TTTGGGTATATATGAAGTAATGG + Intergenic
916782159 1:168045516-168045538 ACAGGTTATTTATGAAGTCAAGG + Intronic
920220354 1:204394230-204394252 ATAGTGTGTTTATGGATCAAAGG + Intergenic
921714256 1:218401878-218401900 ATAGGGTGTTTATGAAGTAAAGG + Intronic
922873808 1:228924163-228924185 ATAGGGCCTCTATGAAGTTAGGG - Intergenic
923897562 1:238289136-238289158 ATAGGGAGTTTAAGAATTACAGG - Intergenic
924864848 1:247967692-247967714 ATAGGAGGTCAATGAAGTAAGGG - Intronic
1065469151 10:26059326-26059348 ACATGTTGTTTATGAAGTTAAGG + Intronic
1072092987 10:92147777-92147799 AGTGGGAGTTTCTGAAGTAAAGG + Intronic
1072936591 10:99719135-99719157 AGAGGGTATTCATGAATTAATGG + Intronic
1073096946 10:100985585-100985607 AAAGGGTGTTTATTAACCAACGG - Exonic
1073894402 10:108137956-108137978 ATAAGGTGTTTATGGAGTATTGG - Intergenic
1075642770 10:124076646-124076668 ATAGGGTGTTTCTGAGCAAAGGG - Intronic
1076285469 10:129291687-129291709 CTAAGATGTTTATGAAATAAAGG - Intergenic
1078850041 11:15155460-15155482 ATAGAGTGCCTATGAAGTACTGG + Intronic
1078910067 11:15722953-15722975 ATAGGGTGTTTATTGAGAAGTGG + Intergenic
1080632085 11:34087289-34087311 TTAGGATTTTTCTGAAGTAAAGG + Intronic
1082923589 11:58522100-58522122 ATTGGGTTTATATGAAGTTAAGG - Intergenic
1083135068 11:60665455-60665477 TTTGGGTGTATATGCAGTAATGG - Intergenic
1085278848 11:75317228-75317250 CTAGGGTCTTTTTGAAGGAAAGG + Intronic
1085999145 11:81957819-81957841 ATAGGGTGATAATGAAATTATGG - Intergenic
1086638271 11:89118500-89118522 TTTGGGTATTTATTAAGTAATGG - Intergenic
1091160845 11:133418278-133418300 ATGGGAGGTTTATGAAGGAAGGG + Intronic
1092136903 12:6155727-6155749 TTAGGGTGGTTGTGAAGAAAAGG + Intergenic
1092801695 12:12174689-12174711 TTAGGGTATTGATGAAATAAAGG + Intronic
1095485437 12:42679763-42679785 AAGGGGTGTTTGTGAAGCAACGG - Intergenic
1100065943 12:90645157-90645179 ATAAAGCGTTTATCAAGTAAGGG - Intergenic
1103065606 12:117894838-117894860 ATAGGATGTTTAGGAAGCATTGG - Intronic
1105788130 13:23769851-23769873 ATAGTCTGTTTATGAAGTCAGGG - Intronic
1107245141 13:38285246-38285268 ATAGTGTGTTTTTAAACTAACGG + Intergenic
1109898763 13:68733383-68733405 ATAGTGTGTTTTTAAAGTATTGG - Intergenic
1110363443 13:74655384-74655406 GGTGGGTGTGTATGAAGTAAGGG - Intergenic
1110378464 13:74821381-74821403 AAAGAGTGTTTTTCAAGTAAAGG - Intergenic
1110998246 13:82140986-82141008 ATAGTGTGTTTCTGAAATACTGG - Intergenic
1116104883 14:40489571-40489593 TTCAGGTGTTTAAGAAGTAAAGG + Intergenic
1116284322 14:42952628-42952650 ATAGATTGTTTGTGAATTAAAGG + Intergenic
1118128470 14:62936166-62936188 ATAGGGAGTAAATGAAGAAAAGG + Intronic
1119989195 14:79175994-79176016 TTAGGAAGTTTATGAACTAAAGG + Intronic
1120365175 14:83559681-83559703 ATAAGATGTTTATGATGCAAGGG + Intergenic
1120542416 14:85766483-85766505 ATAGGATGTGAAGGAAGTAATGG + Intergenic
1120613171 14:86667918-86667940 ATAGGGGGTTTAAGAAAAAAAGG - Intergenic
1121803165 14:96792370-96792392 AAATGGTGTTTATAAAGTATTGG + Intergenic
1125406542 15:39358190-39358212 ATTTGGTGTTTTTGAATTAAGGG - Intergenic
1128588155 15:68869657-68869679 TTAGTGTGTATGTGAAGTAATGG + Intronic
1132377552 15:101340008-101340030 ATAATGTGTTTATTGAGTAAAGG - Intronic
1135226385 16:20662722-20662744 ATTGGGTCTTTATGAAGGGAGGG - Intronic
1135780323 16:25294224-25294246 AAAAAGTGTTTATGAAGTGAAGG + Intergenic
1135880811 16:26254215-26254237 ATAGGGTTTTTATGAAGATTAGG - Intergenic
1139233450 16:65309417-65309439 ACAGGGTGTTTATGGAGACAAGG + Intergenic
1139351077 16:66336199-66336221 AGAGGATGTTTATGAAGGAGGGG - Intergenic
1143500436 17:7335661-7335683 ATAGGGTGGTCATGAAGGGAAGG - Intergenic
1145097651 17:20044881-20044903 ACATGGTATTTATCAAGTAAAGG + Intronic
1146706643 17:35005136-35005158 ATGGGGCCTTTATGAAGAAAGGG + Exonic
1150464455 17:65380212-65380234 ATAGGGTGTGTGTGTAGTATTGG + Intergenic
1151261687 17:72920642-72920664 ATAGGGTGTACATGGTGTAAGGG - Intronic
1155873441 18:31055309-31055331 AAATGGTGTTTATCAAGTAATGG + Intergenic
1156202020 18:34844178-34844200 ATAGGGGGTTGTTGAAGTCAGGG + Intronic
1156844914 18:41654417-41654439 ACAGGGTGGTATTGAAGTAAAGG - Intergenic
1163792624 19:19316626-19316648 TTGGGGTGTTTGTGGAGTAAGGG - Intronic
926620037 2:15039345-15039367 ATAGGGTGTTTCTGAGCTGAAGG - Intergenic
930904275 2:56547414-56547436 AGTAGGTGTTTATGAAGTTAGGG + Intergenic
931931647 2:67144061-67144083 TTAGGGTGTCTGTGAAATAAGGG + Intergenic
931980033 2:67685042-67685064 ATTGGGTCTTTATGAAGGCAAGG - Intergenic
938198168 2:129350864-129350886 AGATGGTTTTTATGAAGTCAAGG + Intergenic
939090194 2:137771302-137771324 ACAAAGTGATTATGAAGTAATGG - Intergenic
940160203 2:150703714-150703736 ATAAGCTGTTTACTAAGTAAAGG + Intergenic
941276453 2:163497035-163497057 TTTGGGTGTATATGCAGTAATGG - Intergenic
941923065 2:170870853-170870875 CAAGGGTGTTCATGAAGTTACGG + Intergenic
942503371 2:176615801-176615823 ATAGCTTGCTTATGAAGTATAGG + Intergenic
942774457 2:179564615-179564637 TTACAGTGTTTATGAAGTAAGGG - Intronic
943730668 2:191300157-191300179 ACAGGATGTTTGTGATGTAAGGG + Intronic
943851637 2:192730468-192730490 ATAGGGAGTTTTTGAGGCAATGG - Intergenic
1169548305 20:6673823-6673845 ATAGGGTGGTTTTTAACTAAGGG - Intergenic
1173349844 20:42234697-42234719 ATATGGTGTGGATGAAGAAATGG - Intronic
1179177240 21:39017307-39017329 ATAGGGCCTTTAAGAAGTGATGG - Intergenic
1179512989 21:41886493-41886515 GGAGGGAGTTTATGAAGCAAAGG - Exonic
1181978077 22:26746566-26746588 AGAGGGTGTGTTTGAAGTATGGG - Intergenic
1183858417 22:40652269-40652291 CTAGAGTGTTGATGAAGTGACGG + Intergenic
1184475928 22:44721311-44721333 ATAGGGTGTACACCAAGTAATGG - Intronic
949625524 3:5862267-5862289 ACAGGGTGTTAAGGAAGTAATGG - Intergenic
950007744 3:9702271-9702293 GTAGGGTCTTTGTGAAGTCATGG - Exonic
955198368 3:56827369-56827391 GCAGGGTGTTTATGAGTTAAGGG + Intronic
955763599 3:62316673-62316695 ATAGGGTTTTTATGAGGATAAGG + Intergenic
956490067 3:69761577-69761599 CTAGGTTTCTTATGAAGTAAAGG + Intronic
958853627 3:99358299-99358321 ATAGTGTGTTGATGAAGGGAGGG + Intergenic
958906851 3:99951226-99951248 ATAATGTGGTTATGAAGTCAGGG - Intronic
960189103 3:114681622-114681644 ATAGAGGGTTTATGGAGTAGTGG + Intronic
962160631 3:132995976-132995998 CCAGGGTGTTTATAAAGAAAAGG + Intergenic
965343777 3:167522014-167522036 ATAGATTGTTTTTGAAGAAAGGG + Intronic
965893968 3:173551022-173551044 ATAAGGTGATAATGCAGTAAAGG - Intronic
971036522 4:22699455-22699477 ATATGATGTTTATGAATGAATGG + Intergenic
973193205 4:47409990-47410012 ACAGCCTGTTTATGAAATAAAGG - Intronic
973324364 4:48843328-48843350 ATAGATAGTTCATGAAGTAAAGG - Intronic
973599827 4:52531138-52531160 AGATGGAGTTTAAGAAGTAAGGG - Intergenic
974167106 4:58217683-58217705 AGAGGGTGTTTATGAAGTCAGGG - Intergenic
975570296 4:75810087-75810109 ATAGGAAATTTATGAAGGAAAGG + Intronic
975716762 4:77212578-77212600 TTAGGGTATTCATGAAGTAATGG - Intronic
979270021 4:118748394-118748416 ATTGTGTGTTTATGAAATTATGG - Intronic
980784406 4:137533346-137533368 ATAGGATTTTTTTGAAGTACAGG - Intergenic
981173942 4:141658820-141658842 CTAGGAAGTTTATGAAGTTAAGG - Intronic
981281460 4:142964638-142964660 AAAGGGTGTTTACCCAGTAAAGG + Intergenic
981911237 4:149983967-149983989 TTAGGGTTTTTATGAAAAAATGG - Intergenic
982503657 4:156191964-156191986 CTAGGCTGTTTATGAAGTTGTGG + Intergenic
983459443 4:168009558-168009580 ATAAGGGGTTAATGATGTAATGG - Intergenic
986344900 5:6825617-6825639 ATAATGTGTTTATGGAGGAAAGG - Intergenic
987741868 5:21919475-21919497 ATAGGCAGCTTATGAAATAATGG - Intronic
997285732 5:132676930-132676952 TCAGGGTGTCTATGAAGTCAAGG + Intronic
998904413 5:146889182-146889204 CTAGGATGCTTATGTAGTAAAGG + Intronic
998986279 5:147761106-147761128 ATAGAGTTTTTGTAAAGTAACGG + Intronic
1001034764 5:168289976-168289998 AGTGGGTTTTTATGTAGTAAAGG + Intergenic
1003415631 6:5905513-5905535 ATAGTGTTTTTAAGAAGCAAGGG - Intergenic
1003747465 6:9018853-9018875 AAATGGAGTTTATGAAGTCAAGG - Intergenic
1003784845 6:9474099-9474121 TTTGGGTGTATATGCAGTAATGG - Intergenic
1005628709 6:27687457-27687479 CCAGCGTGTTTACGAAGTAAGGG - Intergenic
1008067843 6:47069454-47069476 ATAAGGAGTAAATGAAGTAAAGG - Intergenic
1009291583 6:61889459-61889481 GGAATGTGTTTATGAAGTAAAGG - Intronic
1009913417 6:69962191-69962213 AGAGGGTGTAGATGAAGAAAGGG + Intronic
1010778892 6:79920585-79920607 ATAAGGTGTATATGAAGTTTTGG - Intronic
1011361908 6:86535582-86535604 ATAGTGTGTTTATTAAGTTTTGG + Intergenic
1013873301 6:114794385-114794407 ATAGGGAATTTATGATGTAATGG - Intergenic
1014763617 6:125386696-125386718 TTAGGGTGTATATCCAGTAATGG + Intergenic
1015586169 6:134778854-134778876 ACAGGGTCTTGCTGAAGTAAAGG + Intergenic
1017374418 6:153751378-153751400 CAAGGGTGTTTATGATGTCAGGG + Intergenic
1018130660 6:160729760-160729782 ACAGGGTGTTTCTAGAGTAATGG + Intronic
1018716573 6:166537434-166537456 ATATGGTGTTTATGAAATAGGGG - Intronic
1021398975 7:20187546-20187568 ATAGAGTGTTTAGGGAGTAAAGG - Intronic
1022635504 7:32130602-32130624 ATAGGGAGTTAAGGAAGTGAAGG - Intronic
1024451586 7:49551690-49551712 ATAGGATGATGATGAAGAAAAGG - Intergenic
1024654910 7:51443848-51443870 AAAGGGAGTTTATTAAGTATAGG - Intergenic
1026654602 7:72246200-72246222 AGGGGGTGTTTCTGAGGTAAGGG - Intronic
1027451234 7:78334030-78334052 ATAGGTTGGTTATGAAGTGGTGG + Intronic
1027531094 7:79333455-79333477 ATATGCTGTTTATGAACTGAAGG - Intronic
1028107111 7:86891674-86891696 ACTGGGTGTTTATAAAGTAGAGG - Intronic
1029586060 7:101472407-101472429 ACAGGGTGTTTATGGTGGAAGGG - Intronic
1029919306 7:104245530-104245552 CTAGGGTTTTTATGATTTAAGGG + Intergenic
1031802621 7:126267818-126267840 ATAAGGTGTTTATTAGGTTAGGG - Intergenic
1032613646 7:133443030-133443052 CTTGGGTGTTTGTGAAGTAGTGG + Intronic
1033961052 7:146913672-146913694 ATAGGGTTTAGATGAAGTCATGG - Intronic
1034821158 7:154217657-154217679 ATAAGGTGTCTATTAAGAAATGG + Intronic
1036455985 8:8908465-8908487 ATAGGGTGTTTATAAAGGGAGGG - Intergenic
1036647597 8:10621626-10621648 ATATGATATTTATGAAGTATTGG + Intronic
1037453988 8:19045643-19045665 AGAAGGTGTTCCTGAAGTAAGGG - Intronic
1040658969 8:49546586-49546608 TTAGGGTGCTTATGAAGGCAAGG + Intronic
1041047934 8:53904920-53904942 ATAGGATGTTCATTTAGTAATGG + Intronic
1042982543 8:74546849-74546871 ATAAGATGTTTAAAAAGTAACGG + Intergenic
1043040573 8:75257555-75257577 ATAAAGTATTTAAGAAGTAATGG - Intergenic
1043695877 8:83216504-83216526 TTTGGGTGTATATAAAGTAATGG + Intergenic
1043733523 8:83715754-83715776 ATATGTTTTTTATGAAATAAGGG + Intergenic
1045717852 8:105069629-105069651 TTAGGGTTTTTATAAAGCAATGG - Intronic
1047423154 8:124723970-124723992 ATATGGTGGTCATGAAGGAAGGG - Intronic
1048127824 8:131656798-131656820 ATAGGGTGCTTTTGAAGAAGTGG - Intergenic
1050606454 9:7306279-7306301 AGAGGGTGTTTAAGAAGAAAGGG - Intergenic
1056327473 9:85491741-85491763 ATAGGATGTGTGTGAAGTTAGGG - Intergenic
1057815053 9:98287966-98287988 ATGGGCAGTTTATGAAGGAAGGG + Intergenic
1057968357 9:99526979-99527001 AAAGGGTTTTTATACAGTAATGG + Intergenic
1059051283 9:110929108-110929130 ACAGGGTCTTTTTGAAGAAATGG - Intronic
1060259720 9:122063292-122063314 ATAGGTCGATTTTGAAGTAAGGG - Intronic
1185710219 X:2297540-2297562 ATAGGGTGTTTAGACATTAAAGG + Intronic
1185920703 X:4088801-4088823 ATAAGGTGTTTATGTCCTAAAGG - Intergenic
1186296201 X:8151276-8151298 ATAGGTTATTTATTATGTAAAGG + Intergenic
1188344151 X:29043633-29043655 GTTGGGTGTTCATGAAATAAAGG - Intronic
1190959575 X:55233089-55233111 ATAGGGTATATATCAAGTAATGG - Intronic
1193641343 X:84013127-84013149 TTTGGGTATATATGAAGTAATGG - Intergenic
1193824621 X:86207966-86207988 ACAGGGCCTCTATGAAGTAATGG - Intronic
1195245636 X:102992697-102992719 ATAGGGTGAAAAGGAAGTAAAGG - Intergenic
1198000150 X:132425757-132425779 TTAGTGTGATTATGTAGTAATGG - Intronic
1199437711 X:147831778-147831800 TTAGGGTGTATATCCAGTAATGG - Intergenic
1199456816 X:148038302-148038324 GTAGGGTGTTTTCGAAGTCAAGG + Intergenic
1199687385 X:150276494-150276516 ATTACATGTTTATGAAGTAATGG - Intergenic
1200735233 Y:6786966-6786988 ATAGGGTGTACACCAAGTAAAGG - Intergenic