ID: 921719598

View in Genome Browser
Species Human (GRCh38)
Location 1:218455735-218455757
Sequence ACTCACTGACTATGATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921719598_921719599 7 Left 921719598 1:218455735-218455757 CCTTGGGATCATAGTCAGTGAGT No data
Right 921719599 1:218455765-218455787 TCATAGAAATCAGCAATTTGAGG No data
921719598_921719600 8 Left 921719598 1:218455735-218455757 CCTTGGGATCATAGTCAGTGAGT No data
Right 921719600 1:218455766-218455788 CATAGAAATCAGCAATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921719598 Original CRISPR ACTCACTGACTATGATCCCA AGG (reversed) Intergenic
No off target data available for this crispr