ID: 921720266

View in Genome Browser
Species Human (GRCh38)
Location 1:218463505-218463527
Sequence TGTGGTGCCCAGAAGCATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921720266_921720270 1 Left 921720266 1:218463505-218463527 CCTTTATGCTTCTGGGCACCACA No data
Right 921720270 1:218463529-218463551 TCTAGGCGAAAGAGTCTCCTGGG No data
921720266_921720272 18 Left 921720266 1:218463505-218463527 CCTTTATGCTTCTGGGCACCACA No data
Right 921720272 1:218463546-218463568 CCTGGGACCAACACCTAACCAGG No data
921720266_921720269 0 Left 921720266 1:218463505-218463527 CCTTTATGCTTCTGGGCACCACA No data
Right 921720269 1:218463528-218463550 CTCTAGGCGAAAGAGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921720266 Original CRISPR TGTGGTGCCCAGAAGCATAA AGG (reversed) Intergenic
No off target data available for this crispr