ID: 921720454

View in Genome Browser
Species Human (GRCh38)
Location 1:218465043-218465065
Sequence TACCCTAGAATGCATGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921720453_921720454 -6 Left 921720453 1:218465026-218465048 CCAGGGCTGTTGCTAGATACCCT No data
Right 921720454 1:218465043-218465065 TACCCTAGAATGCATGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921720454 Original CRISPR TACCCTAGAATGCATGAGAA AGG Intergenic
No off target data available for this crispr