ID: 921731625

View in Genome Browser
Species Human (GRCh38)
Location 1:218585765-218585787
Sequence CCCCAACTAAACGGCTACCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921731619_921731625 30 Left 921731619 1:218585712-218585734 CCCAGGTCATTCACTATACATTT No data
Right 921731625 1:218585765-218585787 CCCCAACTAAACGGCTACCTCGG No data
921731621_921731625 4 Left 921731621 1:218585738-218585760 CCACAAAATCCTCAGATTCTGAC No data
Right 921731625 1:218585765-218585787 CCCCAACTAAACGGCTACCTCGG No data
921731620_921731625 29 Left 921731620 1:218585713-218585735 CCAGGTCATTCACTATACATTTC No data
Right 921731625 1:218585765-218585787 CCCCAACTAAACGGCTACCTCGG No data
921731622_921731625 -5 Left 921731622 1:218585747-218585769 CCTCAGATTCTGACTGAGCCCCA No data
Right 921731625 1:218585765-218585787 CCCCAACTAAACGGCTACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921731625 Original CRISPR CCCCAACTAAACGGCTACCT CGG Intergenic
No off target data available for this crispr