ID: 921734706

View in Genome Browser
Species Human (GRCh38)
Location 1:218613764-218613786
Sequence ACAGCAAATAAGTATAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921734706_921734712 23 Left 921734706 1:218613764-218613786 CCTCCTCTATACTTATTTGCTGT No data
Right 921734712 1:218613810-218613832 TGTTTGATTAGGTAACACAAAGG No data
921734706_921734710 12 Left 921734706 1:218613764-218613786 CCTCCTCTATACTTATTTGCTGT No data
Right 921734710 1:218613799-218613821 TTGGTGAAACCTGTTTGATTAGG No data
921734706_921734708 -7 Left 921734706 1:218613764-218613786 CCTCCTCTATACTTATTTGCTGT No data
Right 921734708 1:218613780-218613802 TTGCTGTGTAGACACAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921734706 Original CRISPR ACAGCAAATAAGTATAGAGG AGG (reversed) Intergenic
No off target data available for this crispr