ID: 921736407

View in Genome Browser
Species Human (GRCh38)
Location 1:218633535-218633557
Sequence GGTCAGGGTTAGACCTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921736400_921736407 -2 Left 921736400 1:218633514-218633536 CCTGCCCACTGAGGAAGGATGGG 0: 14
1: 48
2: 95
3: 169
4: 470
Right 921736407 1:218633535-218633557 GGTCAGGGTTAGACCTGGAGAGG No data
921736403_921736407 -7 Left 921736403 1:218633519-218633541 CCACTGAGGAAGGATGGGTCAGG 0: 23
1: 65
2: 126
3: 134
4: 363
Right 921736407 1:218633535-218633557 GGTCAGGGTTAGACCTGGAGAGG No data
921736402_921736407 -6 Left 921736402 1:218633518-218633540 CCCACTGAGGAAGGATGGGTCAG 0: 26
1: 63
2: 123
3: 124
4: 278
Right 921736407 1:218633535-218633557 GGTCAGGGTTAGACCTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921736407 Original CRISPR GGTCAGGGTTAGACCTGGAG AGG Intergenic
No off target data available for this crispr