ID: 921739445

View in Genome Browser
Species Human (GRCh38)
Location 1:218667166-218667188
Sequence GTTCTTAGAAGCAGAATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921739445_921739449 15 Left 921739445 1:218667166-218667188 CCCACAATTCTGCTTCTAAGAAC No data
Right 921739449 1:218667204-218667226 ACTCACCCTTGTCTATAAAATGG No data
921739445_921739452 28 Left 921739445 1:218667166-218667188 CCCACAATTCTGCTTCTAAGAAC No data
Right 921739452 1:218667217-218667239 TATAAAATGGCATGTGTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921739445 Original CRISPR GTTCTTAGAAGCAGAATTGT GGG (reversed) Intergenic
No off target data available for this crispr