ID: 921745418

View in Genome Browser
Species Human (GRCh38)
Location 1:218735007-218735029
Sequence CATTAGGCAGGATGGGCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921745418_921745423 -4 Left 921745418 1:218735007-218735029 CCTATTGCCCATCCTGCCTAATG No data
Right 921745423 1:218735026-218735048 AATGAAACACAAAATATGAAAGG No data
921745418_921745424 -1 Left 921745418 1:218735007-218735029 CCTATTGCCCATCCTGCCTAATG No data
Right 921745424 1:218735029-218735051 GAAACACAAAATATGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921745418 Original CRISPR CATTAGGCAGGATGGGCAAT AGG (reversed) Intergenic
No off target data available for this crispr