ID: 921746123

View in Genome Browser
Species Human (GRCh38)
Location 1:218742679-218742701
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 715
Summary {0: 4, 1: 30, 2: 62, 3: 159, 4: 460}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921746118_921746123 14 Left 921746118 1:218742642-218742664 CCATATGGTATGAATAGAATATC No data
Right 921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG 0: 4
1: 30
2: 62
3: 159
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903143178 1:21352274-21352296 AGAGAAAGGGCAGAGGTTGTGGG + Intergenic
904030745 1:27532147-27532169 AGGGAGAGGGAAGTGATGGTAGG - Intergenic
904917020 1:33977471-33977493 AGAGAGAGTGCCCTGATGGAAGG - Intronic
905120882 1:35681008-35681030 AGACAGATTGCAGTGATTTGGGG - Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908033515 1:60027398-60027420 AGAGAGAGTGAGGGGAATGTGGG - Intronic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911012600 1:93297057-93297079 AGTAAGAGCGCAGTGATTTTGGG - Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
911298203 1:96143004-96143026 AGAGAGAATGGAGTAATTGGTGG - Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915011210 1:152687797-152687819 AGAAGGAGTTCAGTGACTGTGGG - Intergenic
915087440 1:153397992-153398014 AGTGAGGGGGAAGTGATTGTTGG - Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916105604 1:161428440-161428462 AGAAAGGGTGTAGTGAGTGTTGG + Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918247107 1:182670040-182670062 AGAAAGAGAGCAGTAATTTTTGG - Intronic
918290891 1:183106955-183106977 AAAGAGACTGCACTGGTTGTGGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918762980 1:188437971-188437993 AGAGAAAGTGCTGAGATTCTAGG - Intergenic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919169705 1:193938553-193938575 GGGGAGAGTGCAGCAATTGTGGG + Intergenic
920436603 1:205950873-205950895 AGAGAAAGGGCAGTGTTAGTGGG - Intergenic
920860751 1:209704533-209704555 AGAGAGAGAGGAGTGCATGTAGG - Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922922562 1:229318854-229318876 AAAGAGAGTGCAGTGCTGGCCGG - Intergenic
923702003 1:236309085-236309107 AGAGAGGGTGCAGATTTTGTTGG - Intergenic
924250901 1:242132173-242132195 AAAGAGAATGCAGTGATTGCGGG + Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063056348 10:2509088-2509110 AGGGAGAGTGGAGTGAATCTTGG + Intergenic
1064112012 10:12547644-12547666 AGAGAGAGTGCAGGGTTGGGGGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1066694331 10:38064548-38064570 AGAGAGAAGGAAGTGATTCTTGG - Intronic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1070464134 10:76702878-76702900 AAGGAGAGTGCAGTGATCATGGG + Intergenic
1070940036 10:80336491-80336513 GGAGAGAGTGCAGTGTGTGAAGG - Intronic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072158409 10:92744393-92744415 AGAGAGACTGCAGTAAATGGTGG - Intergenic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1073320134 10:102610913-102610935 AGAGGGAGTGCAGTGTGAGTTGG + Intronic
1073650404 10:105352543-105352565 ACAGAGAGTACAGTGGTGGTGGG - Intergenic
1073869328 10:107844674-107844696 AGAGAGAATACCGGGATTGTTGG + Intergenic
1074164605 10:110864010-110864032 AGACAGAGTCCAGTGATGGTGGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074975972 10:118581940-118581962 GGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076095799 10:127734402-127734424 AGAGGGACTGCAGTCATTTTGGG - Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1078351836 11:10601339-10601361 AGAGGGAATGCAGTGGATGTAGG + Intronic
1078451657 11:11444910-11444932 CCAGAGACTGCAGTGACTGTGGG + Intronic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1079443280 11:20536259-20536281 AGCCAGAGTGCCGTGACTGTGGG - Intergenic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079760146 11:24319148-24319170 AGAGAGAGTGCAAGGATTGTGGG - Intergenic
1080096879 11:28418775-28418797 AGGCAAAGTGCAGTGAATGTGGG + Intergenic
1080113085 11:28591717-28591739 AGAGAATGTACAGTGAGTGTAGG - Intergenic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1080966640 11:37220567-37220589 AGAGAGAATGCAGTGATCGTGGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1083544588 11:63538846-63538868 GGAGATGGTGCAGTTATTGTAGG + Intronic
1083702826 11:64490924-64490946 AGAGAGGGTGCAGTGGGTGCAGG - Intergenic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085716254 11:78876180-78876202 ATAGAGAGTGCATTGACTGCTGG + Intronic
1085762825 11:79257042-79257064 AGAGACAGAGCAGTGAATGAAGG + Intronic
1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG + Intergenic
1086448303 11:86890811-86890833 AGAGAAAGTCCAGTGGTGGTGGG - Intronic
1087219220 11:95527807-95527829 AGTGAGTGTGCTGTCATTGTAGG - Intergenic
1087370595 11:97279249-97279271 AGGGACAGTGCAGGGATTGGAGG + Intergenic
1087874549 11:103339967-103339989 AGCAAGAGTGAAGTGAGTGTGGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089503584 11:118947904-118947926 AGACAGACTGCAGTGATTTTAGG - Intronic
1089791239 11:120945769-120945791 AGAGAGAGAGCAGTGAGTTCAGG - Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090777168 11:129975707-129975729 GGAGAGAGTGCAGTGGTGGCAGG - Intronic
1092184676 12:6470282-6470304 GGAGAGGGTGCAATGATTGTGGG + Intronic
1092497512 12:9011815-9011837 AGGAAGAGTGCTGTGATTATGGG + Intergenic
1093122902 12:15294604-15294626 GGAGAAAGTGCAGCAATTGTGGG + Intronic
1093259615 12:16918690-16918712 AGACAGACAGCAGTTATTGTGGG - Intergenic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1097380804 12:58893762-58893784 AGAGTGACTCCAGTGTTTGTAGG - Intronic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1099042889 12:77677703-77677725 AGCAAGCGTGCAGTGAATGTTGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099523213 12:83689423-83689445 AAAGACAGTGCGGTGATTGTGGG + Intergenic
1099526013 12:83720341-83720363 AGAGAAAGAGCAGAAATTGTGGG + Intergenic
1099751893 12:86784886-86784908 AGAGAAAGGGAAATGATTGTAGG + Intronic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099781570 12:87202330-87202352 TGAGATAATACAGTGATTGTGGG + Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1101474350 12:105029943-105029965 AGAAAGAGTGCTGTTATTATAGG - Intronic
1101699359 12:107157463-107157485 AGAGAGAGAAGAGTGATTCTTGG + Intergenic
1102266514 12:111490810-111490832 AGAGAGAGAGAAATGACTGTGGG + Intronic
1103151999 12:118648850-118648872 GCAGATAGTGCAGTGATTGAGGG - Intergenic
1103246466 12:119462146-119462168 AGAGACAGGGCAGTCACTGTTGG - Intronic
1103470946 12:121180634-121180656 AAAGAGAGGGTAGTGATTGGAGG - Intronic
1104889099 12:132131480-132131502 CGACAAAGTGCAGTGATTGTCGG - Intronic
1106499641 13:30315496-30315518 AGAGTAAGTGCTGTGATGGTGGG - Intergenic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107765752 13:43732797-43732819 AGAGAAAATGCAGTGAGTGTTGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108270298 13:48752709-48752731 AGAGAGAGAAATGTGATTGTGGG - Intergenic
1108776765 13:53774445-53774467 GGAGAGAGTGCTGGGGTTGTAGG + Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1113079537 13:106503703-106503725 AGAGAGAGTCCAGTGGCAGTGGG - Intronic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113446273 13:110370130-110370152 AAAGAGAGTGATGTGATTCTAGG - Intronic
1113704297 13:112415984-112416006 AGAGGGAGGGAAGTGAGTGTGGG - Intronic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1114392299 14:22322923-22322945 AGAAAGAGTGCTGAGATTGGAGG + Intergenic
1114820428 14:26011235-26011257 AGAGAGAGTAAAGAGATTGGAGG + Intergenic
1114994289 14:28328467-28328489 AGAGAGAGTGAAGTGATCCTGGG - Intergenic
1115485964 14:33911592-33911614 AGAGAGAGTCCAGTGGCAGTGGG - Intergenic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116686437 14:48045156-48045178 AGAGAGAGTGCAGATAGTGATGG + Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117499315 14:56336533-56336555 AAAGAGAATGAAGTGATTATAGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1117795546 14:59389370-59389392 AGAAAGAGTGCAGTGGTTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118654231 14:67930089-67930111 AGGTAAAGTGCACTGATTGTAGG + Intronic
1118747995 14:68787542-68787564 AGAGAGAGGGCTGTGGCTGTGGG - Intergenic
1119648559 14:76366911-76366933 ACAGTGAGTACAGTGATTGATGG - Intronic
1119872563 14:78029788-78029810 AGAGAGAGAGCAGAAAATGTGGG - Intergenic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1121836512 14:97097272-97097294 AGAAAGAGTGCAATGAGTATCGG - Intergenic
1122628971 14:103098842-103098864 AGAGACAGTCAAGTGATTGATGG - Intergenic
1124947202 15:34280016-34280038 AGACAGAGTGAAATGATTGTGGG + Intronic
1125271505 15:37943737-37943759 GGAAAGAGTACTGTGATTGTAGG - Intronic
1126489145 15:49216808-49216830 AGGGAGGGTGAAGTGAGTGTGGG - Intronic
1126660829 15:51031470-51031492 AGAGGGACTGCAGTGATTGTGGG - Intergenic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1126881710 15:53105960-53105982 AGAGACAGTGCAGTGCTCCTAGG + Intergenic
1126979948 15:54229156-54229178 AGAGAGAATGCAGTAATTGCAGG - Intronic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1127619756 15:60722377-60722399 AGAAATAGTGCAGTGAGTGATGG - Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128668421 15:69555781-69555803 AGAGAGATTGGAGTGGTTGGGGG - Intergenic
1128714935 15:69901099-69901121 AGAGAGAGTGCAGGAGTTGGAGG - Intergenic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1129198890 15:73986905-73986927 AGAGAGAGTGCATGGAGTGGAGG + Intronic
1129605909 15:77024918-77024940 GGAGAGAGGGCTGTGAATGTGGG + Intronic
1130395879 15:83500821-83500843 AGAAAGAGTCCAAGGATTGTGGG - Intronic
1130909589 15:88262009-88262031 AGAGAGGGTTCAGTGAATCTCGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1131990526 15:98088710-98088732 AGAGAGTTTGCAAAGATTGTGGG + Intergenic
1132099618 15:99014585-99014607 AGAGAGTTTGCAAAGATTGTGGG - Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1134537354 16:15036754-15036776 TGAAGGAGAGCAGTGATTGTGGG + Exonic
1134779800 16:16885424-16885446 GGAGAGAATGCAGTGGTGGTGGG + Intergenic
1135949827 16:26903705-26903727 AGAGAGAGTGGATAGATAGTTGG + Intergenic
1136241527 16:28947570-28947592 AGAGAGAGTTTAATGATTGCAGG + Intergenic
1137859975 16:51836832-51836854 ATAGAGTGTGCAGAGATTGGGGG + Intergenic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140317274 16:73911308-73911330 AGGTAGAGTGCAGTCAATGTGGG + Intergenic
1140711851 16:77686022-77686044 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1140729110 16:77840127-77840149 AGAGAGCCTGCAGTGAGTGGTGG + Intronic
1140776178 16:78250667-78250689 GGAGAGAGTCCAGTGATGGCGGG + Intronic
1141376604 16:83536490-83536512 AGTGGGAATGCAGTGAGTGTGGG + Intronic
1141707980 16:85679796-85679818 AGAGAGACTGTAGTGGTGGTGGG - Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143141200 17:4742693-4742715 TGAGAGCGTGCAGGGATTGGGGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143669511 17:8386725-8386747 AGAGAGAGTGCAGTCAGACTAGG - Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1147312111 17:39601551-39601573 AGCCAGAGTGCAGGGAATGTGGG + Intergenic
1148102719 17:45102523-45102545 AGAGAAAGAGCAGTGAGTGTGGG + Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149198958 17:54160298-54160320 AGAGAGAGAGACGTGAGTGTTGG - Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149578811 17:57733103-57733125 AGAGACAGTGAAGAGATTGGTGG - Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151001958 17:70387949-70387971 AGAGAGAGTGCTGTGTCTGTTGG + Intergenic
1152823579 17:82449744-82449766 AGAGAGAGAGCTGAGATCGTTGG - Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155979515 18:32165927-32165949 AGAGAGAGGGAAGGGCTTGTAGG - Intronic
1155986785 18:32238565-32238587 AAAGACAGTGCAGTCACTGTTGG + Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159647960 18:70942470-70942492 GGACAGAGCGGAGTGATTGTGGG + Intergenic
1159775443 18:72598856-72598878 AGAGAGAGTGCAGCAATTTTGGG - Intronic
1160299059 18:77662850-77662872 AGAAAGAGTTCACTGATCGTAGG - Intergenic
1160597011 18:79982720-79982742 AGAGAGAGGGAAGTTACTGTGGG + Intronic
1163600742 19:18247815-18247837 AGGGAGGGTGCAGAGAGTGTGGG - Intronic
1164590400 19:29503775-29503797 AGAGAGATGGGACTGATTGTGGG - Intergenic
1164985636 19:32646449-32646471 AGAGAGAGTTCAGGTATTCTGGG - Exonic
1167471921 19:49680221-49680243 AGAGAGACTGGAGAGATGGTAGG + Intronic
1168177637 19:54636095-54636117 AGAGAAAGGGCAGAGAGTGTGGG + Intronic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
925699059 2:6614370-6614392 ACGGAGAGTGCTGTGAGTGTGGG - Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928089555 2:28365889-28365911 GGAGACAGTGGAGTGAATGTAGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928715648 2:34056696-34056718 AGGAAGAGTGCCATGATTGTGGG - Intergenic
928767855 2:34670003-34670025 AGAAAGAGTGTAGTGACTCTGGG + Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
929726898 2:44439291-44439313 AGAGAGAGAGGATTAATTGTAGG - Intronic
930049357 2:47202657-47202679 AAATAGAGTCTAGTGATTGTGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
932268796 2:70390918-70390940 AGACAGAGTTCACTGACTGTGGG + Intergenic
932456558 2:71853103-71853125 ACAGAGAGTGCAGGAAGTGTGGG - Intergenic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
933266881 2:80190247-80190269 GGAGAGAGTCCAGTGGTGGTGGG + Intronic
933559304 2:83872285-83872307 GGAGAGAGTCCAGTGGTAGTGGG - Intergenic
934039809 2:88118414-88118436 AGAGTAAGTACAGTGATTGGTGG - Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935194347 2:100803362-100803384 AGAAACATTGCAGTGATTTTCGG - Intergenic
936237169 2:110752525-110752547 AGAGAGAAAGTAGTGATTGAGGG + Intronic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936538824 2:113333652-113333674 AGAGAGCACGCAGTGAGTGTGGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936914945 2:117630716-117630738 AGAGAGACTGTTGTGATTGCTGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937373655 2:121320221-121320243 GGAGAGAGTGCTGTTACTGTTGG + Intergenic
937851207 2:126638066-126638088 AGAGAGAGTGTTGAGAATGTGGG + Intergenic
937854672 2:126663690-126663712 GGAGAGGGTGCAGTGAATGCTGG - Intronic
938190702 2:129277591-129277613 CGAGAGAGTGGAGTGATTGAAGG - Intergenic
938208354 2:129442756-129442778 AGAAAGAGTGTAGTGATCGCAGG - Intergenic
938251033 2:129815941-129815963 AGAAAGAGTGTAATGATTGCAGG + Intergenic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
940191328 2:151043103-151043125 AGTGAGACTACAGTTATTGTGGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942577134 2:177375587-177375609 AGAGACAGTGCCCTGATTATGGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943029582 2:182670102-182670124 AGAGAGAATCCAGTGGTGGTGGG - Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943238205 2:185348964-185348986 AGATAGAGGGAAGGGATTGTTGG + Intergenic
943558047 2:189428939-189428961 CCAGAGGCTGCAGTGATTGTGGG + Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944005278 2:194897097-194897119 AGAGAGAGTGCAACTATTGTGGG - Intergenic
944129785 2:196335327-196335349 AGAGAAATTCCAGTGACTGTAGG - Intronic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944550159 2:200838331-200838353 AGAGAGGGCGCAGAGTTTGTGGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944855209 2:203760514-203760536 AGAAAGAGTGCAGTGATTGCAGG - Intergenic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
946875327 2:224124021-224124043 AGAGAGAGAGGGGAGATTGTGGG - Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947195910 2:227567566-227567588 AGAGAAAGTCCAGTGTTTATAGG + Intergenic
947247489 2:228065766-228065788 AGAGACAGTGCATTGATTTGAGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948058931 2:235029545-235029567 AGAGAGAATGGTGTGTTTGTGGG - Intronic
948428918 2:237906257-237906279 AGAGAGTGTGCCGTGCCTGTAGG - Intronic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
948726308 2:239936145-239936167 AGAGAGTGAACAGTGACTGTTGG + Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1168906125 20:1405182-1405204 AGAGAGAGTCCAGTGGTGGTGGG + Intergenic
1169275282 20:4229653-4229675 GGACAGAATGCAGTGATTGAGGG + Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170142006 20:13133775-13133797 AGGGATGGTCCAGTGATTGTAGG + Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170485032 20:16807275-16807297 AGAAAGAGTTCAGTGATTGCAGG - Intergenic
1170818356 20:19734389-19734411 AGAGAGAGAGAAATGATTTTTGG + Intergenic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171002854 20:21432276-21432298 AGAGAGAGTTCAGAAATTTTTGG - Intergenic
1171882907 20:30631359-30631381 AGAGAGAGTGCAGGGCTGGCAGG + Intergenic
1171942787 20:31347933-31347955 AAAGGGGGTGCAGTGATTGTGGG + Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174695409 20:52551828-52551850 AGGCAGAGTGCAGTGATGATGGG - Intergenic
1175488843 20:59365103-59365125 AGAGACAATGCAGTTATTCTGGG + Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177222330 21:18210291-18210313 AGGGGAAGTGCCGTGATTGTGGG - Intronic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177849725 21:26332458-26332480 AGAGAGAGTGTAGTGATTCTGGG + Intergenic
1177904282 21:26956572-26956594 AGAGATAGTGAAATGATTGTGGG - Intronic
1178365539 21:31986346-31986368 AGAGAGAGTGCAGGGGTTGGAGG - Intronic
1179033579 21:37741265-37741287 AGAGAGAGTCCAGAGGGTGTGGG - Intronic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1182743564 22:32587336-32587358 AGAGGGAGGGCAGTGGGTGTTGG + Intronic
1184726976 22:46352878-46352900 GGACAGAGTGCAGCCATTGTTGG + Intronic
949792988 3:7813779-7813801 GGAGAGAATGCAGTGTCTGTAGG - Intergenic
950801197 3:15552974-15552996 AGGGAGAGTGCCGTAACTGTGGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951379643 3:21968104-21968126 AGAGAGAGGAAAGGGATTGTGGG + Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952052862 3:29407161-29407183 AGCAAGTGTGCAGTGATTGTTGG - Intronic
952662528 3:35868954-35868976 GGAGAGAGTCCAGTGGTGGTGGG - Intergenic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952720247 3:36524739-36524761 GGAAAGAGTGCTGAGATTGTTGG + Intronic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
953753868 3:45630421-45630443 AGTGAGAGGGAAGTGTTTGTGGG + Intronic
955214077 3:56970580-56970602 AGAGACAGTGCAGGGGTTGGAGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956221549 3:66909367-66909389 TGAGAAAGTACAGTGATAGTTGG + Intergenic
956276535 3:67508028-67508050 AGAAACAGTGCAGTGGTGGTAGG + Intronic
956383645 3:68693029-68693051 GGAGTGAGTGCAGTGAGTGCAGG - Intergenic
956426359 3:69139717-69139739 GGAGAGAGTCCAGTGGTGGTGGG - Intergenic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957889593 3:86339321-86339343 AGAGAGTGTGAAGTGTGTGTTGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959306834 3:104677980-104678002 AGGGAGAGTGAAGAGATAGTGGG + Intergenic
959361493 3:105399319-105399341 AAAGCTAGTGCAGTGATTGTTGG + Intronic
959716769 3:109442442-109442464 AGGGAGACTGCAGCAATTGTGGG + Intergenic
959750843 3:109832856-109832878 TGATAGAGTGGAGTGATGGTGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
959913841 3:111794297-111794319 AGAGAGGGTGCAGTGACTGCGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960802687 3:121555307-121555329 AGAGAGAGTGCATGGGTGGTGGG + Intergenic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
961199453 3:125032718-125032740 AGACAGAGAGAAGTGATTGTAGG + Intronic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964630171 3:158801859-158801881 AAAGACAGTGCAGTAATTGGTGG + Exonic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965014673 3:163141148-163141170 AGAGAGAGAGCAGTTATTATTGG - Intergenic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966036789 3:175426868-175426890 AGAGAGAGTGCTGTATTTGTAGG + Intronic
966141830 3:176766299-176766321 AAGAAGAGTGCAGGGATTGTGGG + Intergenic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
967878101 3:194280425-194280447 ATAGAGAGTGCAGTCCTTGAAGG - Intergenic
968543298 4:1179234-1179256 AGAGTGAGTGCTGTGTTTGCTGG - Intronic
969728698 4:8940566-8940588 AGAGACAGAGCAGTGATGCTGGG - Intergenic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974292181 4:59947478-59947500 AGAAAGAGTGTAGTAATTGCGGG + Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976762888 4:88569267-88569289 AAGGAGAGTGCCGGGATTGTGGG - Intronic
977153275 4:93541413-93541435 AGTGAGAGTTAAGTGATTCTTGG + Intronic
977616190 4:99089410-99089432 AGAGAGAATGTAGTATTTGTCGG + Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
977913956 4:102570090-102570112 AGAGAGAGTGTGGTGATTACTGG - Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978947024 4:114512067-114512089 AGAGAGAATGCACTGGTTGGAGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979935456 4:126688883-126688905 ACAGAGAGTGCAGTATTTGCAGG + Intergenic
979958243 4:126982121-126982143 AGAGAGAGTGAAGAGATTTGAGG + Intergenic
980646581 4:135651331-135651353 ACAGAGGGTGCAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981394597 4:144233255-144233277 AGGGACAGTGCATTGATTGAGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
982126487 4:152188335-152188357 AGCGAGAGTCAAGTGATTGCAGG - Intergenic
982483188 4:155935920-155935942 AGAGAGAATGCAGGAGTTGTTGG - Intronic
982502780 4:156178809-156178831 AGAGAAAGTAAAGTGTTTGTAGG + Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982932570 4:161428075-161428097 AAGGAGAGTGCAGTGGTTTTAGG + Intronic
982993109 4:162304720-162304742 AGAGATAAAGCAGTGATTTTAGG + Intergenic
983008845 4:162520093-162520115 AAAGACAGTGCTGTGATTGGAGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983411392 4:167402971-167402993 AAAGAGAGGGCAGTGTTAGTCGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
985142325 4:186854316-186854338 AGACAGTCTGCAGTGATTGGGGG + Intergenic
985405939 4:189638447-189638469 AGAGAGAGTGCTTTGAGCGTGGG - Intergenic
985670459 5:1204021-1204043 AGAGAGAGTGCGCTGTCTGTGGG - Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986214116 5:5702164-5702186 AGAGAGAGTGCAGGGGGTGAAGG + Intergenic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
987365763 5:17147198-17147220 ACAGAGAGTGTAGGGAGTGTAGG + Intronic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988335428 5:29902310-29902332 AAAGAAAGTGCAGTGATTCAAGG + Intergenic
988608644 5:32704159-32704181 AGACAGAGTGCAATGACTGTGGG - Intronic
990199542 5:53355794-53355816 ACAGAGAGGGCAGAGATTGGAGG + Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991093898 5:62719482-62719504 AGAGCGAGTGGAGTGGTGGTGGG - Intergenic
991106479 5:62849532-62849554 AGATAAAGTGCATTTATTGTAGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
991926416 5:71709593-71709615 ACAGAGAGTTCACTGGTTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993198662 5:84783224-84783246 AGAGAGAGTGGGGGGGTTGTGGG + Intergenic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994292842 5:98050517-98050539 AGAACAAGTGCAGTGATTGCAGG + Intergenic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995697908 5:114900389-114900411 AGGAAGAGTGTTGTGATTGTGGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
999610205 5:153361274-153361296 AGAGTGAGTTCAGAGAGTGTTGG - Intergenic
1000581576 5:163040841-163040863 AGAGAAAGTGAAGTGAGCGTGGG + Intergenic
1001671665 5:173478735-173478757 AGAGACAGTGCAGGAGTTGTGGG - Intergenic
1006126512 6:31842220-31842242 AGTGAAAGTGCTGTGATTCTAGG + Intergenic
1007001767 6:38320078-38320100 GGGGAGAGTGCTGCGATTGTGGG - Intronic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1007267166 6:40605378-40605400 AGGGAGAGTGCAGCTATTGATGG - Intergenic
1008238792 6:49083692-49083714 ATGAAGAGTGCAGTGATGGTGGG + Intergenic
1008304633 6:49886448-49886470 AGAGAGAGTGCATTGATCACGGG - Intergenic
1008532434 6:52476054-52476076 AGACAGTGTGCAGTGAATGGAGG + Intronic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009321664 6:62298099-62298121 AGAGAGAGAGCAGTGGTGGTGGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010557815 6:77306526-77306548 AGTGAGAGTGCAGGAATTGTGGG - Intergenic
1010618186 6:78040681-78040703 AGAGAGAGTGCAGGGGTAGCGGG + Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012003509 6:93684305-93684327 AGAAAGAGGGCAGTGATTGGGGG + Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012111103 6:95234840-95234862 ATAGAGAGTTGAGTGATGGTAGG - Intergenic
1012737430 6:102967886-102967908 AAAGAGAGTGAATGGATTGTAGG - Intergenic
1013881698 6:114910627-114910649 TTAGGGAGTGCAGTGATTCTGGG - Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014378651 6:120711156-120711178 ACGGAGAGTCCACTGATTGTGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1015612495 6:135039615-135039637 AGATAGAGTGCAGAGTTTGAAGG - Exonic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017650389 6:156576169-156576191 GGGGAGAGTGAAGTGAGTGTGGG + Intergenic
1018940349 6:168305384-168305406 AGAGTGAGTGCAGTGGGTCTGGG - Intronic
1019066301 6:169302206-169302228 AGAGAGAGTCAAATGAATGTGGG + Intergenic
1019087001 6:169487947-169487969 AGAGAGAGTGCTGTGTCTGTGGG - Intronic
1019359958 7:599643-599665 AGAGAAGCTGCAGTGATGGTGGG - Intronic
1019381342 7:725953-725975 AGGGAGAGGGCAGTGCTTATTGG - Intronic
1019995676 7:4722929-4722951 AGAGGCAGGGCAGTTATTGTAGG + Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021383398 7:19996959-19996981 ACTGAGACTGCAGTGATGGTTGG - Intergenic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1021899266 7:25267104-25267126 AGAGAGGATGCAGAGATTGCAGG + Intergenic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022355019 7:29606557-29606579 AGAGAGAGGGCAGTGGATGGAGG - Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022771315 7:33475792-33475814 AGAGCGAGAGGAATGATTGTTGG + Intronic
1022798037 7:33748577-33748599 AGAGAGAGTACAGGGAATGGAGG - Intergenic
1023267626 7:38424195-38424217 AGATAGAGTTCATTGACTGTGGG - Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023661834 7:42478260-42478282 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026189520 7:68112133-68112155 AGAGAGGGAGCTGTGATTATGGG - Intergenic
1026613236 7:71879499-71879521 TGAGAAAGAGCAGAGATTGTGGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028049456 7:86163881-86163903 GGAGAGAGTCCAGTGGTGGTTGG + Intergenic
1028921881 7:96318807-96318829 ACAGTGAGTGTAGTGAGTGTTGG + Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029175887 7:98664193-98664215 AGAGAGAGTTTAATGATTGCAGG - Intergenic
1030327015 7:108230363-108230385 AGAGAGAGTAGAGAGACTGTTGG - Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1030842833 7:114377385-114377407 AGAGAAAGTGAAGTCATTCTGGG + Intronic
1031009409 7:116509910-116509932 AGAAAGATGGCAGTGATTATGGG - Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031306148 7:120130320-120130342 AAGGAGAGTGCAGTAATTTTGGG + Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1032601381 7:133299894-133299916 AGAGAGATATCAGTGCTTGTTGG - Intronic
1032906888 7:136378372-136378394 AGATAGAGGACAGTGGTTGTAGG + Intergenic
1033004923 7:137551292-137551314 AGAGAGAGAGCAGTAAGTGTTGG + Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034408754 7:150924939-150924961 AGAGAGAGTGCTCAGAATGTGGG + Intergenic
1034415544 7:150962644-150962666 AGAGAGAGAGGAGTGACTGCTGG + Intronic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034733404 7:153407511-153407533 AGAGAGAGTGTAGGCTTTGTGGG + Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1034925762 7:155120149-155120171 AGAAAGAGTATAGTGATTGCAGG - Intergenic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1036261193 8:7241664-7241686 AGAGGCAGTTCAGTGAGTGTAGG - Intergenic
1036305411 8:7597883-7597905 AGAGGCAGTTCAGTGAGTGTAGG + Intergenic
1036313232 8:7700208-7700230 AGAGGCAGTTCAGTGAGTGTAGG - Intergenic
1036356261 8:8045880-8045902 AGAGGCAGTTCAGTGAGTGTAGG + Intergenic
1036401089 8:8409133-8409155 AGAGAGAGAGAAGAGAATGTAGG - Intergenic
1037245839 8:16833883-16833905 AAAGAAAGTGCAGAGACTGTGGG + Intergenic
1037646424 8:20796522-20796544 AGAGATACTGCAGTGAAAGTTGG - Intergenic
1037770466 8:21796147-21796169 AGAGGGAGTGCAGTGTCTCTGGG - Intronic
1038428055 8:27477928-27477950 AGAGATGCTGCAGTGAGTGTGGG - Intronic
1038515639 8:28185575-28185597 AGAGAGAGTGCTGTGAATTCTGG + Intronic
1039133545 8:34294804-34294826 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1039392085 8:37189463-37189485 AGAGAGAATGGAGAGAGTGTGGG + Intergenic
1040292147 8:46131004-46131026 GGTGAGACTGCAGTGATTGCTGG - Intergenic
1040293512 8:46137491-46137513 AGAGAGACTGCAGGGATTGCTGG - Intergenic
1040300072 8:46183398-46183420 AGTGAGACTGCAGTGAATGCTGG - Intergenic
1040317806 8:46274191-46274213 AGAGAGATTGCAGGGAATGCTGG + Intergenic
1040332144 8:46391156-46391178 AGAGAGACTGCAGGGAATGCTGG + Intergenic
1040592895 8:48811502-48811524 AGAGAGAGTGCATTCAATTTGGG + Intergenic
1040641646 8:49341168-49341190 AGAGAGTGTGCATAGATTGAGGG + Intergenic
1041415890 8:57608739-57608761 AGACAGAGTGCAATGACTGGGGG + Intergenic
1041500719 8:58535405-58535427 AGAGAGAGTCCAGTGGCGGTGGG + Intergenic
1041754410 8:61298108-61298130 AGATAGATTGCAATGAGTGTAGG + Intronic
1041852353 8:62405565-62405587 ACGGAGAGAGCAGTGATTATGGG - Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043313488 8:78891811-78891833 AGAGGGAGAGCAATGGTTGTTGG - Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044639448 8:94363153-94363175 AGGCAGGGTGCAGTGATTTTTGG + Intergenic
1045172659 8:99687634-99687656 CGGGAGAGAGTAGTGATTGTGGG - Intronic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1046215617 8:111141604-111141626 AGAGAGAGTGAAGTGATTATAGG - Intergenic
1046268878 8:111866798-111866820 AGAGACAGGGTAGAGATTGTAGG - Intergenic
1046754965 8:117963345-117963367 AGAGAGAGTCCAGTGGTGGCTGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047181031 8:122588318-122588340 AGAAAGAGTGTAGTGGTTGCTGG - Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048557921 8:135499120-135499142 CGAGAGAGTGCAGTTGTGGTTGG + Intronic
1049272331 8:141702572-141702594 AGAGGTAGAGCAGGGATTGTGGG - Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051229920 9:14945379-14945401 AAAGAGAAAGCAGTGATTATGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056267807 9:84916853-84916875 AGAGAGATGGCAGTGATTTACGG + Intronic
1056338703 9:85602853-85602875 AGAGAACATGCAGTGACTGTGGG + Intronic
1056496805 9:87163936-87163958 ACATAGAGTGAAGAGATTGTTGG + Intergenic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1057988077 9:99737916-99737938 AGAGAGGGTGCACTGGGTGTGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058445797 9:105053802-105053824 AGAAAGAGTTCAATGATTGCAGG - Intergenic
1058770251 9:108224053-108224075 GGAGACAATGCAGTGATTGTAGG - Intergenic
1059431279 9:114251867-114251889 AGACACAGTGCAGTGAGGGTGGG - Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059733136 9:117076124-117076146 TGAGAGAGAGCTGTGATTGGGGG + Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1061230891 9:129315340-129315362 AGAGAGAGAGGAGGGATGGTGGG - Intergenic
1062518417 9:136947353-136947375 GCAGAGAGTGCAGTGGCTGTGGG - Intronic
1187132591 X:16517163-16517185 AGAGACAGCCCAATGATTGTGGG + Intergenic
1187284781 X:17894545-17894567 TGAGAGAATGCAGTGATTTGGGG - Intergenic
1187384612 X:18836763-18836785 AGAGGGGGTGCAGTGTTTCTGGG - Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188715521 X:33455711-33455733 AGGGAGAGTGCAGCAATTCTGGG + Intergenic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189310611 X:40014880-40014902 CGAGAGAGGGCGGTGAGTGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189640650 X:43067449-43067471 AAGGAAAGTGTAGTGATTGTGGG + Intergenic
1189760227 X:44314580-44314602 AGAGAGAGTGGAGGGAATGGTGG - Intronic
1190224236 X:48533335-48533357 AGAGTGAGTGAAGTGATTAGGGG - Intergenic
1190498451 X:51051566-51051588 AAAGAGAGTAAAGTGATTATGGG + Intergenic
1190521508 X:51282852-51282874 AAAGAGAGTAGAGAGATTGTGGG + Intergenic
1190626888 X:52345406-52345428 AGAGGGAGTGGAGGGGTTGTAGG - Intergenic
1191025198 X:55907090-55907112 ATAGAGAGTGCCTGGATTGTGGG + Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG + Intergenic
1191930503 X:66366446-66366468 TGACAGAGTGCAGGGATAGTAGG - Intergenic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192069528 X:67922544-67922566 AGAGAGAGTGTAGTGGTTGTGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193098221 X:77578040-77578062 AAGGAGAGTGCAGTGATCATAGG + Intronic
1193293838 X:79809925-79809947 AGAGCCAGGGCAGGGATTGTTGG + Intergenic
1193440952 X:81538647-81538669 AGAGAAAATGAAGTGATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195396040 X:104411667-104411689 GGAGAGAGTGCAGTCATCATTGG + Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195618738 X:106932835-106932857 AGTAAGAGTTCAGTGAGTGTGGG - Intronic
1195823204 X:108969769-108969791 AGAGAAAGTGCAGCAATTGTGGG + Intergenic
1195863208 X:109402881-109402903 ACAGAGAGTCCAGTCATTGGTGG - Intronic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196740753 X:119023928-119023950 AGAGAGGATGCAGTAAGTGTTGG - Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197030595 X:121809192-121809214 AGGGACAGTGAAGTGAATGTGGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198274123 X:135085525-135085547 AGGGAGAGTGTAGTTATAGTGGG - Intergenic
1198700542 X:139392745-139392767 AGAAAGAGTTCAGGGATTGGAGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1198999215 X:142613604-142613626 AGACAGAGTGCACAAATTGTTGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199431839 X:147770667-147770689 AGAGAGAGTTCAGTGGCTGTGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199595976 X:149505980-149506002 ACAGAGAGAGCAGCAATTGTGGG + Intronic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic