ID: 921747772

View in Genome Browser
Species Human (GRCh38)
Location 1:218756932-218756954
Sequence ATGGGGATGTGAAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921747765_921747772 1 Left 921747765 1:218756908-218756930 CCAGAGGCTGTGCTGTGGTGGGG No data
Right 921747772 1:218756932-218756954 ATGGGGATGTGAAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921747772 Original CRISPR ATGGGGATGTGAAATGAGGA TGG Intergenic
No off target data available for this crispr