ID: 921751910

View in Genome Browser
Species Human (GRCh38)
Location 1:218804478-218804500
Sequence CTGCCTCCTAAGTGCAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921751906_921751910 27 Left 921751906 1:218804428-218804450 CCAGATATTTGTGATTTTGTGCC No data
Right 921751910 1:218804478-218804500 CTGCCTCCTAAGTGCAAAGCTGG No data
921751909_921751910 4 Left 921751909 1:218804451-218804473 CCAGTGTATCAAAGAGAAAATCA No data
Right 921751910 1:218804478-218804500 CTGCCTCCTAAGTGCAAAGCTGG No data
921751907_921751910 6 Left 921751907 1:218804449-218804471 CCCCAGTGTATCAAAGAGAAAAT No data
Right 921751910 1:218804478-218804500 CTGCCTCCTAAGTGCAAAGCTGG No data
921751908_921751910 5 Left 921751908 1:218804450-218804472 CCCAGTGTATCAAAGAGAAAATC No data
Right 921751910 1:218804478-218804500 CTGCCTCCTAAGTGCAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921751910 Original CRISPR CTGCCTCCTAAGTGCAAAGC TGG Intergenic
No off target data available for this crispr