ID: 921752885

View in Genome Browser
Species Human (GRCh38)
Location 1:218817994-218818016
Sequence CTCTGTAAGGGGAGGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921752885_921752897 2 Left 921752885 1:218817994-218818016 CCCGCCCCCCTCCCCTTACAGAG No data
Right 921752897 1:218818019-218818041 AGACTGGACATCTGTGCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921752885 Original CRISPR CTCTGTAAGGGGAGGGGGGC GGG (reversed) Intergenic
No off target data available for this crispr