ID: 921754139

View in Genome Browser
Species Human (GRCh38)
Location 1:218833794-218833816
Sequence TTTCCTTCACTTGGGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921754139_921754146 14 Left 921754139 1:218833794-218833816 CCATGTTCCCCAAGTGAAGGAAA No data
Right 921754146 1:218833831-218833853 CCTTTTACACTACCTTAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921754139 Original CRISPR TTTCCTTCACTTGGGGAACA TGG (reversed) Intergenic
No off target data available for this crispr