ID: 921754978

View in Genome Browser
Species Human (GRCh38)
Location 1:218844713-218844735
Sequence AATCACATGCTGCATATATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921754978_921754982 30 Left 921754978 1:218844713-218844735 CCCAATATATGCAGCATGTGATT No data
Right 921754982 1:218844766-218844788 TAATTTATGGTTAAATACATAGG No data
921754978_921754981 17 Left 921754978 1:218844713-218844735 CCCAATATATGCAGCATGTGATT No data
Right 921754981 1:218844753-218844775 GAATGAAATTATATAATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921754978 Original CRISPR AATCACATGCTGCATATATT GGG (reversed) Intergenic
No off target data available for this crispr