ID: 921754981

View in Genome Browser
Species Human (GRCh38)
Location 1:218844753-218844775
Sequence GAATGAAATTATATAATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921754978_921754981 17 Left 921754978 1:218844713-218844735 CCCAATATATGCAGCATGTGATT No data
Right 921754981 1:218844753-218844775 GAATGAAATTATATAATTTATGG No data
921754977_921754981 18 Left 921754977 1:218844712-218844734 CCCCAATATATGCAGCATGTGAT No data
Right 921754981 1:218844753-218844775 GAATGAAATTATATAATTTATGG No data
921754979_921754981 16 Left 921754979 1:218844714-218844736 CCAATATATGCAGCATGTGATTC No data
Right 921754981 1:218844753-218844775 GAATGAAATTATATAATTTATGG No data
921754976_921754981 19 Left 921754976 1:218844711-218844733 CCCCCAATATATGCAGCATGTGA No data
Right 921754981 1:218844753-218844775 GAATGAAATTATATAATTTATGG No data
921754980_921754981 -6 Left 921754980 1:218844736-218844758 CCATTTATATAAAGAATGAATGA No data
Right 921754981 1:218844753-218844775 GAATGAAATTATATAATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921754981 Original CRISPR GAATGAAATTATATAATTTA TGG Intergenic
No off target data available for this crispr