ID: 921754982

View in Genome Browser
Species Human (GRCh38)
Location 1:218844766-218844788
Sequence TAATTTATGGTTAAATACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921754978_921754982 30 Left 921754978 1:218844713-218844735 CCCAATATATGCAGCATGTGATT No data
Right 921754982 1:218844766-218844788 TAATTTATGGTTAAATACATAGG No data
921754979_921754982 29 Left 921754979 1:218844714-218844736 CCAATATATGCAGCATGTGATTC No data
Right 921754982 1:218844766-218844788 TAATTTATGGTTAAATACATAGG No data
921754980_921754982 7 Left 921754980 1:218844736-218844758 CCATTTATATAAAGAATGAATGA No data
Right 921754982 1:218844766-218844788 TAATTTATGGTTAAATACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921754982 Original CRISPR TAATTTATGGTTAAATACAT AGG Intergenic
No off target data available for this crispr