ID: 921755943

View in Genome Browser
Species Human (GRCh38)
Location 1:218855840-218855862
Sequence AACCCAAGAGAGCTGAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921755938_921755943 19 Left 921755938 1:218855798-218855820 CCCAAAGATCCCAGAACTGTAGG No data
Right 921755943 1:218855840-218855862 AACCCAAGAGAGCTGAAGCATGG No data
921755942_921755943 9 Left 921755942 1:218855808-218855830 CCAGAACTGTAGGATCACGTGCA No data
Right 921755943 1:218855840-218855862 AACCCAAGAGAGCTGAAGCATGG No data
921755940_921755943 18 Left 921755940 1:218855799-218855821 CCAAAGATCCCAGAACTGTAGGA No data
Right 921755943 1:218855840-218855862 AACCCAAGAGAGCTGAAGCATGG No data
921755941_921755943 10 Left 921755941 1:218855807-218855829 CCCAGAACTGTAGGATCACGTGC No data
Right 921755943 1:218855840-218855862 AACCCAAGAGAGCTGAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921755943 Original CRISPR AACCCAAGAGAGCTGAAGCA TGG Intergenic
No off target data available for this crispr