ID: 921757010

View in Genome Browser
Species Human (GRCh38)
Location 1:218869431-218869453
Sequence GTGGGGAACTAGAAATATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921757010_921757016 19 Left 921757010 1:218869431-218869453 CCATCATATTTCTAGTTCCCCAC No data
Right 921757016 1:218869473-218869495 TTTACTCTCACTTCAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921757010 Original CRISPR GTGGGGAACTAGAAATATGA TGG (reversed) Intergenic
No off target data available for this crispr