ID: 921763309

View in Genome Browser
Species Human (GRCh38)
Location 1:218941434-218941456
Sequence GACAGTGAATGAGTCTCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921763306_921763309 30 Left 921763306 1:218941381-218941403 CCTGTGGGAGTTGACTGAATTAT No data
Right 921763309 1:218941434-218941456 GACAGTGAATGAGTCTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921763309 Original CRISPR GACAGTGAATGAGTCTCATG AGG Intergenic
No off target data available for this crispr