ID: 921763593

View in Genome Browser
Species Human (GRCh38)
Location 1:218944607-218944629
Sequence GCGTATATCTACAGGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921763593_921763600 6 Left 921763593 1:218944607-218944629 CCGTCCACCCTGTAGATATACGC No data
Right 921763600 1:218944636-218944658 AGGGTAGGATCTCTAGTGCCTGG No data
921763593_921763599 -9 Left 921763593 1:218944607-218944629 CCGTCCACCCTGTAGATATACGC No data
Right 921763599 1:218944621-218944643 GATATACGCTTCATGAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921763593 Original CRISPR GCGTATATCTACAGGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr